Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T24D1.2   

sjj_T24D1.2 RNAi JA:T24D1.2
PF:GL1_4D9
PCR_productsjj_T24D1.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T24D1.2 Source_evidenceePCR768WS150 Sequence/Annotation Release
Chunk_score Abs_score704
Max_abs_score704T24D1.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI99540239955149
Overlaps_transcript T24D1.2.2 Source_evidenceePCR768WS150 Sequence/Annotation Release
T24D1.2.1 Source_evidenceePCR768WS150 Sequence/Annotation Release
WB_DNA_textsjj_T24D1.21127ggcactttttgcatccttgtggttttattggtggattggaacacattgtacaatctccccacgtggaatctctgaaatgtttttatttttatcaagtattctggaagcttacggggttattcatgtgctgtcgaaaattacaaaaaaaaaatttttgtatattttgacggcacatgaataagcccattatgaagaaagacttacggttcaactagttttcctccagctgacactggttttgcagctggaacgatatattcttcttcatcatgatacaattctagttcatgattgtacatgacacgatcttcgtcgaatatcggttgtcttatgtgatttctatcggcatgaactgctccccttccaccaataatcagaacatcatcatcatcacttagatcaataactgatgaaccatttgattgagcttcatcatcatcagaatctgcgtctacattctcaggatcactttcatcttcattattcaatccagaacggtaaagtggatctcttcgtggattatcaggatatatacgggaatgaagtagatcacgtatataatctgcactgatgttgtgttggccacttccacgatatcttccaggtgttatcactctaccacggcctcctggacctcttccgcttcttgcatatgatcctcttggattaaatgcacgtggcatgtctctttcttcatgatcagattcagcctcagagtctgcatcagattcagatgatgagattgtaatcgtcgcatttcgttcttcttcttcttcattgtcgctctgcgtataatcactgtcatcgtcgtcatctgggaaataggtttccgccctggaaattattatttttttaaataattcaatttagatattgatgtattctactaacgttatatcacgtatttcatctccctggcgtacttgaacacgatctccttcaaattgcatttgagggtctgcaaaaaataatcaaatttgtaagaatgttatctatatgatagttttcgaaaatatttcaaaattttcgtaaaaatactatttttttctgctattataggctcaaaatatgtccaaataaacgaacaatttctcactaatatttaatggggattcacagttttggaa