Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T24E12.6   

sjj_T24E12.6 RNAi (4)
PCR_productsjj_T24E12.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST24E12.6 Source_evidenceePCR378WS150 Sequence/Annotation Release
Overlaps_Gene T24E12.6 Source_evidenceePCR795WS150 Sequence/Annotation Release
Chunk_score Abs_score650
Max_abs_score650T24E12.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII37604883761551
Overlaps_transcriptT24E12.6 Source_evidenceePCR795WS150 Sequence/Annotation Release
WB_DNA_textsjj_T24E12.61064gacgtctgaaaggagcaagcgggcttcaactcaaaaaatctatgaaaaagttaccattctttttcttctgataatctgcgtaaaacatcctatcgtcttttgacagaacaggcactcccgagcctgaaaatcgagattttggtggcctatgcctacgtaggccgtcttcaaagcaagccaggctaaaataaaacattctcactttcaacgatttcctcacacttcatgattctctctatatgctgtccagattgcagatacttgaagaaataatctttctgaatttttttctgatttttaacgtgaaatttaattacctcaagaagtctccgatggatccgtttcttgatgttcactgcgttttggtcgtacgtcatttttgcatctctctaaaaaaatttatagttttcagcggcgagcaacaaagtcctactaacctgctcgaacttcttatagatcgcctccactcgatcctcagatcttttgtaatgatcattcatagcattcgtaaaaattatgctccgtttcataactggatcacaatccgggagcaaaaaaccttctcctgagaacacgaaattttggacaattttctaaaattttcagtatatatcttttcaaattttagacatttgttaaaaataccagctgctcaaactcctcgtgtgatggctccaagttaaaatagtgaaccttgttttgtccaaagtcagaagctttcggttggggctcggcgagctcgaaatttgggcatcgaactttgctcggcggctctctggcttctaggtcagttggcactaattctggaactagttggagaggtagagactggaaaaaaaatgaattttatcaggaaaaaactatatactcaccggaaaaattgagttgggtgggtaggtgagcaggatttgcgggttcggatgagccggcaaatttaagaattgtgtgggcgggtgattgttgaccaggtaggagtaagtggtgttgaagtcggggagctggaagttatgaactttgttttggaataaaagaaatgaaactcaccgtcggatctaagtttggga