Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T25G3.2   

sjj_T25G3.2 RNAi JA:T25G3.2
PF:GL1_1B2
PCR_productsjj_T25G3.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T25G3.2 Source_evidenceePCR883WS150 Sequence/Annotation Release
Chunk_score Abs_score801
Max_abs_score801T25G3.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI75579137558939
Overlaps_transcript T25G3.2.1 Source_evidenceePCR883WS150 Sequence/Annotation Release
T25G3.2.2 Source_evidenceePCR883WS150 Sequence/Annotation Release
WB_DNA_textsjj_T25G3.21027ccaagtacatgtcgattgcgtacgcgttcgtaatgttggctgtgttagtcgctaccagcagtcaaattgttctcgagagtgcgtttttacattatcccttcatcctgattacgacaattttcagctgttctcgctcctacatctctcttcattgtcacaatggtcggaatcttcttctttgctgcatgtcttcatccaaaagaattcacgaatattatccatggtgtcgtattcttcctcatgattccatctacatatgtgttcctcactttatattcgctcatcaatctcaacgttatcacgtggggaactcgtgaagctgtcgctaaggcaacgggacaaaagacgaaaaaagcgcctatggaacaatttatagacagagtgattgatattgtgaaaaagggattcagattaatcagttgtcgggagaagaaggaacatgaagagagacgagagaaaatggaaaagaaaatgcagagaatggagctagccttgagaagtattgaggttatctttaactttagaaatgtgaaattaataatttattttcagagtggtgccgacgtgaagaaaattctcgatgcaacagaggagaaggagaaacgtgaagaagaaactcaaactgcagattttccgattgaagagaacgtagagaagactcaaaaagagattcagaaggcaaaccgttatgtgtggatgacaagtcatagcttgaaagtttgtgaacgaggaaaactgaaaagtgcggaaaaggttttctggaacgagctcatcaatgcatatctgaaaccgatcaagacgacgccagctgaaatgaaagccgtcgccgaaggattggcttctctacgaaatcagattgctttcactattcttctcgttaattctcttcttgctcttgccatctttttgattcagaaacacaaaaatgtgctcagcatcaagttctcgccaatcagtaagcaatattacctttatggtcaattcaaaaaatttgttttttttttctagaaaacttccgatggacgaa