Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T26E3.3   

sjj_T26E3.3 RNAi JA:T26E3.3
Simmer:T26E3.3:Screen_A
Simmer:T26E3.3:Screen_B
PCR_productsjj_T26E3.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST26E3.3 Source_evidenceePCR376WS150 Sequence/Annotation Release
Overlaps_Gene T26E3.3 Source_evidenceePCR376WS150 Sequence/Annotation Release
Chunk_score Abs_score313
Max_abs_score313T26E3.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1266959312671450
Overlaps_transcriptT26E3.3 Source_evidenceePCR376WS150 Sequence/Annotation Release
WB_DNA_textsjj_T26E3.31858cgaaaaatccaaattttcagatgtcctacaacggctcctaccatcaaaatcatcattcaacacttcaagtcaaatcgaaatttgattctgaatggcgtcgtttctcaataccaatgcattctgcgtctggtgtctcttacgatgggttccggaggtgatttttggccatttttagccgaaaaatcgaaaaattcagcgttttttttttacctaaaatacgtcaaaacccatgtttttgacgtagaaaaacgttaaaaattgatttctctacccaaaagttactgaaattgtcatttttaggcataaaatcccttaaaattcagaaaatcggattttcaacgattttcagctgaaaaatccaaggattcggcgttttttgtcctaaaatacgcggaaaatgattttttttacttgaaaaaatcagattttttccgatttttaccttgaaaaccctaaaaaatctattttccaaaccaaacttggccaaaatcggcatttttagggctaaaatcatgcgtaaatcgaattttcgccattttcagccggaaaatcgaaaaattcgtctttttttttgtgtttttttttaccaaaaacgagcggaaaatgatattttacctgaaaactcgatttttgaagcaattttcccgtaaaagttcaatttttcaagtaaaaatcgatattttcagccttgtcgagaagcttcatcacctggaaagtgtccaattcacactgtgctacaactcgactggcggtgatcttctaccaatcacaaatgacgatgttagtagcggaaaactgaagaaaattgattttttcagtgaaaaaaaaaacgaaaaaatcgagtaaaaatgacataaaattgatatttttcactaaaaaatgctaaaaattcaattaaaatgtctcgaaaattgattttttcagcttaaagttagtcaaaatcgatttttaaaacagctcaaaaatcgttaaaaaataaaaataataataataaaaaaatcgatttaatattcgggtgtctcctacgaggacaaaaaatcgatcgatttgaaaactcacagaaaagtcgaaaaaaatcacaaaaaatcaattaaaaattgatttaaaaactcaaaaaatcgataaaaatctcaaaaaaaaatcgataaaaatcgataaaaagtctataaaaatctgaatgttagtagggaaaactgaagaaaattgattttttcggtgaaaaaatcgagaaaaatcgagtaaaaatgacctaaaattgatatttttcactaaaaaatgctgaaaattactaaaacatcacttatcgataaaaatcacaaaatttcgctaaaaaatcactaaacatcttaaaaaatcgataaaaagtcctaaactacaaaaaattgatttaaaaaaatcgaaaaaagtctcaaaaaattgaaacaaaaatcacaaaaattcggtgaaaaatccccaaaaaatcaataaaaatcacaaaaagaatcgataaaaaattacaaaaaaactcaaaaatcgctttaaaaaatcaatacaaaaccccaagaaatcggaaaaaatcgataaaaaatcgataaaaatctgttgaaaaatcacaaaaattcggtaaaaaatccccaaaaaatcaataaaaatcacaaaaagaatcgataaattcctagaaaaatcccaaaaatcgataaaatcccaaaactaccattattttttttgcagaacctccgaaaatcgttcgaatcggctcgcccactgctccgtttgctcattcaacgccgcggtgaatcatgggaagagaaatatggttatggtacagactctgataaacgatggaagggaatttcatcacttatggcacaaaaaccac