Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T27F2.1   

sjj_T27F2.1 RNAi JA:T27F2.1
Simmer:T27F2.1
PF:GL1_7A12
PCR_productsjj_T27F2.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T27F2.1 Source_evidenceePCR870WS150 Sequence/Annotation Release
Chunk_score Abs_score828
Max_abs_score828T27F2.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1164837411649243
Overlaps_transcript T27F2.1.1 Source_evidenceePCR870WS150 Sequence/Annotation Release
T27F2.1.2 Source_evidenceePCR870WS150 Sequence/Annotation Release
WB_DNA_textsjj_T27F2.1870cgttccctgaaattcacgttgctcagtttcctctcggattaggtcttggagatatgagaggaaagccagaaaatacgctcgccttgcaatatggaactgatggaaagttacaacacgatgctattgctcgtatcggacatgttaaggataaagttgtctactccaagcttaatgatatgaaagccaagacgtggaacgaggatgatgatgatattcagaaaccagacgatgacgctgttatcgatgctacggagaagacaagaatggctttggaaaaaatcgtaaattcaaaagtagcctcagcacttcctgttcgtcatgccgacaagttagcacctgctcaatatatcagatacactccaagtcagcagaatggagctgctggatcacaacagcgcatcatcagaatggttgaagaacaaaaagatccgatggaaccaccaaagttcaaaatcaatcagaagattcctagagcaccaccatctccaccggcaccagtcatgcattctcctccaagaaaaatgacagctaaagatcaaaacgattggaagattccaccatgtatttcaaattggaaaaatccaaaaggattcacagttgggttggacaaacgattggctgctgatggacgtggtctccaacagactcatattaatgaaaactttgcgaagcttgctgatgctttgtacattgctgatagaaaagctcgtgaagaggttgagacacgtgctcagcttgaaagacgcgttgctcaaaataagaagtctgagcaagaggctaaaatggcagaagccgcagcaaaagcccgccaggaaagatcagcgatgcggagaaaggacgatgaagatgatgaacaagtcaaagttcgcg