Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie

RNAi_reagent: sjj_T27F6.3   

Overlaps_Gene T27F6.9 Chunk_score Abs_score704
T22F3.1 Chunk_score Abs_score674
C48D1.6 Chunk_score Abs_score725
C50H2.9 Chunk_score Abs_score204
Overlaps_pseudogene T27F6.9 Source_evidenceePCR756WS150 Sequence/Annotation Release
C48D1.6 (2)
T22F3.1 Source_evidenceePCR833WS150 Sequence/Annotation Release
WB_DNA_text sjj_T27F6.3_1996tttgcggaccaaacattacatgattatcgattttttctgaattttatttcaattttttgattttttcgtttttccaattttcattatttttttttgaattatcaataaaacgcactctgtttgttgcactggatttgtttggttgataaattatttttaaggtatggtaaaatctgttgggtgtaaaaatctttccttggacgtcaagaaagccattgtagctggcttcgaacaaggaatacccacgaaaatgctcgcgctgcaaattcaacgttctccgtcgactatttggaaagtaatcaagaagtaccaaactgaggtgagttcgaaaaatattattttttaataataaatgtttagaaatccgtcgctttgagaatctcgcccggcaggcctcgagtgacaacccataggatggatcgcaacatcctccgatcagcaagagaagatccgcataggaccgccacggatattcaaatgattataagttctccaaatgaacctgtaccaagtaaacgaactgttcgtcgacgtttacagcaagcaggactacacggacgaaagccagtcaagaaaccgttcatcagtaagaaaaatcgcatggctcgagttgcgtgggcaaaagcgcatcttcgttggggacgtcaggaatgggctaaacacatctggtctgacgaaagcaagttcaatttgttcgggagtgatggaaattcctgggtacgtcgtcctgttggctctaggtactctccaaagtatcaatgcccaaccgttaagcatggaggtgggagcgtcatggtgtgggggtgcttcaccagcacttccatgggcccactaaggagaatccaaagcattatggatcgttttcaatacgaaaacatctttgaaactacaatgcgaccctgggcacttcaaaatgtgggccgtggcttcgtgtttcagcaggataacgatcctaagcatacttctcttcatgtgcgttcctggtttcaacgtcgt