Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T28F2.6   

sjj_T28F2.6RNAiJA:T28F2.6
PCR_productsjj_T28F2.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST28F2.6 Source_evidenceePCR1035WS150 Sequence/Annotation Release
Overlaps_Gene (6)
Overlaps_transcriptT28F2.6 Source_evidenceePCR1035WS150 Sequence/Annotation Release
WB_DNA_textsjj_T28F2.61134agcaagcccttgagaaaacaaaaaatatatattggggaagaaaattatttattttctatatatataaagagggacaatcaaataatagtcgggacctctttacgaacgaacgatgcgaagtacacggcgaaccttcttgcggcggtatcctccggttggggagccaccagcggctggagctggtggtggggcggctgctggagctggagccggttcaggggcggcagcagcggctggagcaggtggtggtgcggctgcaccggcagcagctcctccttggtaacctccggctggggcagcagcagcggctggagctggagccggttgaggggcggcagcagcggctggagctgcttcaggggcagcaccggcacctccatcgtatcctccagcaggggctgctgcagctgcatctcctccttcaggataagctccggctcccaaggttcttggtgggcatggacaataggcagcatctggtcctggagctccatcggttcctggtgctccagctggtccgtctggtccagcttctccatcttttcctggtggtcctggtggtcctggtgttccggctggtgatggttgagcatacgcgtcctctcctgctggtccggctggcccaggtggtcctgctggtcctggaggtccaggttggttggtgctggtagttccaccggctcctggctgtccgtctggtcctggagctccaggctgtccatctggtcctggtggtcctgctggaccagcaggtcctggttcagcatatccagctccttctccgtcaggtcctgcggctccagctggtcccgctggtccagcatttccatctggtcctggtggtcctggtggtccggctgggcatgtgatgcagttgcctgcggctccagcgtaggtgtcagcagaaccagcctctccagcagctccatcttgtccggcctctcccggctcaccatcagctccggcttctcctggaggtcctggtggtcctgccgggcatccggatgcttgagcagcacactggcaaccgcctcctccaccagctccttcagcgtagccttcttttgctggagtagcagcagcagcggcgtctcctccggcatattgtctcttgacacgtccgaacaatccttc