Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W02A11.3   

sjj_W02A11.3RNAiJA:W02A11.3
PCR_productsjj_W02A11.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W02A11.3 Source_evidenceePCR1101WS150 Sequence/Annotation Release
Chunk_score Abs_score1038
Max_abs_score1038W02A11.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1273782412739715
Overlaps_transcript W02A11.3.1 Source_evidenceePCR1101WS150 Sequence/Annotation Release
W02A11.3.2 Source_evidenceePCR1099WS150 Sequence/Annotation Release
WB_DNA_textsjj_W02A11.31892cagcaaattttgaactgaaatccgccattttagaaaaattttttgagttgaaaattcactttttctcaccttatgaaccttatgagttgaaaaagtgattttttcagtgattttcagcagattttagggctgaaaaagtgatttttgacgctaaaatctgactcatcacgtgagaaattaatcctttattttccgttcttaagctcatttttggctccgtagagcagcaaaaaatccaaatattttccaggtaactccagctggagatgaactccgcaccgcttcttgtcgacccgagcacacaatcggcaaccgtcgttgccgaaactcaaccgttcggcgatcgttgcatgctggaatccttaattcgtcggcctttctgcatgaatccacagcttcagacacatccgtacgatcggcaaccgacaactgcgccgagggtgagtaccattttggtcatttctaaccgaaaaactgggagaattttcagcttcaaatgatgccacgccgagatcagacacaaaatccagtgatcgccgagctcatgagcaccgtgactcgtgtgagagatcggaagcgtcaacgagatgaggaggcgatgtacccgcgacgaagtgtgggactgcagaccgacactgaagacgtctccgaagtgctcgatgggggcactcgcatttccgatatgaaacgggttcggcgcgaggtaattggtttcgggggcggaaggtcgttagtggcggcttcggattgactgagaacttccggtggggatggctggaagccttgggatcctctggatcctgagatccaaaggatctctgtagcttttttgattcacaagataggcatgggtgatcccactggaagatctgataactgaaagagaatccttatgatcctcatctaggtagcctaggataagcatcggaacaggaggatctgcctctgagatctttgggatcctcggatataccacttgagcttaggattttcagaaagatcagtagattctagcgggttacgatctttatattcggctaggatcctgagctagatcaactagtcttttactataaaaacatggttttaaggatccttgggatattatcaatctttaataatttcaggaactgctcgaccaatcatcactcgacggtatcaccttcgaaacatccggaacgaacacttccgatgaacctcattcacaaataatcacgtcaaattcttcatctctaccttcaacgtcagcatcatcgtcatcagaccgccctcgagccatgcgcagcaaccaggaaatgcgacaagctcgacgagcccgtcgccagcgtcagacccagcacgagtcacagcggatgcaattggagcatcgtcttcagcagattacgggtcctgttcccggttcagaacacaactgtatgacgggatgtccacaccttcatcagcaacaacaacaacagcatcagcaaccgcttctgcatatccaattgaatccaattccacctcaaccacaaacgggtcccaattcggtgtcgccgacgattgctccaggagccatgcttcgtgcgcatccactcgcatcaacattcccctatttttcactgccactcacacaaaactatccggtgatgatggtacttccgatggcagcagttgctcaacaacacgctgcagccgctgcagcagtagtcgccgtcgcggcggcggcagcggtaccacaaccacctccaccacctccacagccgacgcttcacgctccggttccgattcgtccgcagaacaatccgtacaatttgtacgccttcagaaattcacctattaatgtggtgagttcttttttctttttttgagctatttaatcatttttctttactgagaaaacgttaagctttcga