Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W02A11.6   

sjj_W02A11.6RNAiJA:W02A11.6
PCR_productsjj_W02A11.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene (9)
Overlaps_pseudogene W02A11.6 Source_evidenceePCR862WS150 Sequence/Annotation Release
Map_statusBest_ePCRI1275424712755108
F23H12.10 Source_evidenceePCR598WS150 Sequence/Annotation Release
Map_statusTop50_percentile_ePCRV1237619112377051
WB_DNA_text sjj_W02A11.6_1862ttcaaaagaagctccaaactcagatggcaacgacactccgaactaacggtagcgcgcactctttaccgtaaattctcctcattttcgaaattatttttccaccatttatttttctttttcttcgatttttctttgttttcttcatcaattctttgatttttcggcaaaaataattattttccgtatatttattggtgtttcagcattttcgacgttgacacgaacgattgggattgcacggaaatggctggaggagagaaaggagagaaatgcgatttcaactggttggaatgacgtcgatgatgatcacagtgtatgttcataataaaatatttcaatgtaatgtaaattttaaacattttagaaaatacgaggaaatcttcccaccaatagttcgaatttgtcgtcgctaagcccacaccttcttggctcggatcatgctttgcagagagaattaaccttacaaagtgagttttaaaatcaatttttagctcctttggaaaaaacgagcggttcctctcaactttaacgttaattttttacagaaagatgcggaatgatgtcaaactcctcgagctgtcgccgacagatgctcattttctacgttaccgcccatctgatgctgctcagaatcacagaataaacaattcgatcaagtggctgctaatgatggatccaagaaatcgggaatcgagacgaggcttacactaagccgaaatattaaataatatttatgtttttttttccgttttttcaaatttattttttcattcttcatgtacaataaacgaaatttttggcaatttttctctttttgtattaacatttaataacaaaaagcagtattcccggtatataaggg
sjj_W02A11.6_2861cccttatataccgggaatactgctttttgttattaaatgttaatacaaaaatagaaaaattgccaaaaatttcgtttattgtacatgaagaatgaaaaaataaatttgaaaaaagggaaaaaaaaacataaatattatttaatatttcggcttagtgtaagcctcgtctcgattcccgatttcttggatccatcattagcagccacttggtcgaattgtttattctgtgattctgagcagcatcagatgggcggtaacgtagaaaatgagcatctatcggcgacagctcgaggagtttgacatcatcccgcaaatttctgtaaaaaattaacgttaaagttgagaggaaccgctcgttttttccaaaggagctaaaaaattgattttaaaactcactttgtaaggtaaattctctctgcaaagcatgatccgagccaagatggtgtggcttagcgacgaaaaattcgaactattggtgggaagatttcgtcgtattttctaaaatgtttaaaatttacattacattgaaatattttattatgaacatacactgtgatcatcatcgacgtcattccaaccagttgaaatcgcatttctctcctttctctcctccagccatttccgtgccatcccaatcgttcgtgtcaacgtcgaaaatgctgaaacaccaataaatatacggaaaataattatttttgccgaaaaatcaaagaattgatgaagaaaacaaagaaaaatcgaagaaaaagaaaaataaatggtgaaaaaataattcgaaaatgaggaggatttacggtaaagagtgcgcgctaccgttagttcggagtgtcgttgccatctgagtttggagcttcttttgaa