Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W02A11.8   

sjj_W02A11.8RNAiJA:W02A11.8
PCR_productsjj_W02A11.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW02A11.8 Source_evidenceePCR762WS150 Sequence/Annotation Release
Overlaps_Gene W02A11.8 Source_evidenceePCR762WS150 Sequence/Annotation Release
Chunk_score Abs_score678
Max_abs_score678W02A11.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1275851912759425
Overlaps_transcriptW02A11.8 Source_evidenceePCR762WS150 Sequence/Annotation Release
WB_DNA_textsjj_W02A11.8907cgggtatgctgatgttgatgatcttcacgtctatgtttattgtggaaatacgccggaacttcgtctacaggagctcgttgctgatgttaaaatcactattcaaccagaaaatgagaaaagctgttgcattaaaaagtttctcagtttgaaagataataaattcgaaagtattgcaatgagtgctgattttggagatttcgatgaaatggtgtacaactatgcgattgatggaaagtgtacgattgaagctgatattactattatcaaagaagttggagacgcaagagctaagctgagagattttggagaagaaacgagggatgtatcagatgtcgtgattaacgttcagaatgagaagttccatgtttccaaaatggtatctatttctgagatattcaagatatattttcaatgatttttcagtttctggccgctcaatcatctcacttcaagcttctcttcaaaaattccaacgattctgaaattgctttggatggaatcattccagaagattttcaaaatttcctggaacttctctacggtgaaccagcgctgactggtaggtttctgaaaaatttgaagcctttactacaaaaatattatttcagaggacagtgtcgagggaatcctacaaattgctgccagatttgatgtttccacggttattcgtaaaggtgaagactttctgctccaaaaatcggaattttcacctgagaagaagctgcaaatgtctttgaagtataatttggagaatctcaaggttttgctcgattctgtgctaaaatgttttgtatactgaaaattttcagagtaaatgcctttccgaggtcaaatcagttgctgatattcgttccgttttgccaaaggacataaaagaaatggatcattctgtaatggcggagctctt