Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W02B9.1   

sjj_W02B9.1 RNAi JA:W02B9.1
Simmer:W02B9.1:Screen_A
Simmer:W02B9.1:Screen_B
PCR_productsjj_W02B9.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS W02B9.1a Source_evidenceePCR892WS150 Sequence/Annotation Release
W02B9.1b Source_evidenceePCR892WS150 Sequence/Annotation Release
Overlaps_Gene W02B9.1 (3)
E03H4.8 Chunk_score Abs_score383
Specificity_index0.205
Rel_score0.451
M142.7 Chunk_score Abs_score67
Specificity_index0.036
Rel_score0.079
W05B2.3 Chunk_score Abs_score95
Specificity_index0.051
Rel_score0.112
T07C12.5 Chunk_score Abs_score339
Specificity_index0.182
Rel_score0.399
R05D8.12 Chunk_score Abs_score131
Specificity_index0.07
Rel_score0.154
Overlaps_transcript W02B9.1b Source_evidenceePCR892WS150 Sequence/Annotation Release
W02B9.1a Source_evidenceePCR892WS150 Sequence/Annotation Release
WB_DNA_textsjj_W02B9.11636cttgcatgtacttcaaaaatcccaatttttatgagaaaaatctcaaagttctcctcgatttttccgtccaaactctctcacctggaatcccttattctgtccctgtgtgccaagtgtaatctgattaacttgcaacgagaatggttctcccttatccaactgcgtagataccgtatacgcattatcgatcgacaagctcgcccgagtcggattcctcgtgaattggagccaataactcgcattctccttgagcaacacctccgacacacgaagttcctgtcgagcacgtcgtcctccggttccgatatcgaattttccggcggcagtgactccattttgaccggattccaaattcgttgaaacgtaactctgttgggagtctgttccgaacgagagctccgccggtgctccattcacttttccagaaatgaagagaagctcaatgtcggatacttgttccgggaatgcaatgcgtggagagtactgaaaattggagagtttttggaaataaagtaggaaaaaaagtgtagtttgtagtcagaagctcaataatattgtagtttgtagtctaaagcgcaaaaatcttgtagttcctagcctaaggctcaaaaatattgtagtgtgtagtctaaagctcaataatattgtagtttatagtctaaagcaggggtgtgcggcaaatttgccgaatttgccgtttgccgaacacggcaaatttcaaaaaagtagatttgccgaatttgccgagctcggcaaatttcgaaatttgccgcacacgtcaaaaattttacagtacaattttgactaaaattattgattttttcgccaaaaatttagtaaaatgacacaaaattgatgcttaagcagacatactacacggaactaattcagaaaccagatgtgttaagaattcggtagttttggtgttccaaaaaacatcaaaaattatcaatattttccgagtttgccgagctcggcaaatattgaaaaaggagatttgccgaatttgccgagctcggcaaattttgagatttgccgcacacccctggtctaaagctctaaaatcttgtagtagttagctgaaaaattgccaaaatcaacgattttcacatatcgtgaagttctagtttgtagtctaagccgcacctcaataaaagctccctgtgcgaattgaatccattccattcgtcgttcacatcgtgctccaccccatcccggatcacaaacacacttggcaaccatcgcacccgaaccctgaacatccgcaaaacagtctccatgaatgcaatgattcaacgagtcgactgagttactgtcacacgtggctccccacagcctacaacccttttcagagttttgctcgaaagcgggtgtcgccagatcgtactgatctccgttaacattcaaattgcggacgcatccatttagtccggcccgtggaattgtctgtggatagtcttgaccggatagcggagccaatccaccaatctgtacaggtgtcacaatattcaaacgttcatcatcgtcaggtgtatacaactcggctctacacgaagaatcatcggcgccggcgcccaagaatcggcaattatcaacgacgagttcgacgcgttttccctcctgattcacagaaata