Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W02D3.4   

sjj_W02D3.4RNAiJA:W02D3.4
PCR_productsjj_W02D3.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW02D3.4 Source_evidenceePCR872WS150 Sequence/Annotation Release
Overlaps_Gene W02D3.4 Source_evidenceePCR872WS150 Sequence/Annotation Release
Chunk_score Abs_score767
Max_abs_score767W02D3.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI67196786720856
Overlaps_transcriptW02D3.4 Source_evidenceePCR872WS150 Sequence/Annotation Release
WB_DNA_textsjj_W02D3.41179acattgcagctcccagaagtataaaattcttctttccacgaatttctcgataatagaatatgctccaagcggccgcaatacatccaggcatttgagaaataatgggaaatgttacggtttgtgataaatgttgatttgccacgaagaatgatgtttgagcgacagcccacagacatcctgcagccattccaggaaggaataagtttggaggagcgtatggctggtttcttctataaataaatcatgattaaaatgctccaacaagttcgtcaaatatttttaaatctatgtattcctaattaaaattattagacgtacctaaaaatggaatagatgacgaaaatgatagtggatgtaatgaaaattccaaaataatgggagaagacgtacgaaataccatcttgtggataaaatggatatctgaaaataaattaaaaaacaatcgactcaatcttggaatacagcttacaattgtggattatcaatcattctgatcactggtacaaatgtcattccgtaaaagaatccggcaacaatggcagtgatgaaggcgctgaaaaaactgtattttttgaataaaatttattaaagcttacaaaaatctctgagttcctgaattaagatttttatccggtctcaacacttcagtttccagaccgccatcatctgatgattctgtcgtgttcaatgccttcttctcttcagaattcagattctccaaatcgaaagatgtacgactggttttcttggcaattggtaaaggttctgatcgaacttgtgcgaagattgatccaccaataacaacaaaaacaagaccgagatagtttagaaatggagatgcagggacttgagccttcattccaaaaagtccaaatcgaccgccagcccatcccaccaagcaatttgaagtattccaaacaagaatagaaacggcgagtcccaggcgagaaatgattggaatcgctgttgcattacctggaattttcttaatcttttgattatatagttttttaaataattttctcagttggaataaaaaatttagaaattatttcaaaatgaaaaagtataattccgataaaaagtataatttccgacccaccaatgcaccatgatgctccaccaagcattgcaagtggatagaatccaggaaatcctgtcgtggcaaaaacaatgaaa