Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W02F12.5   

sjj_W02F12.5 RNAi JA:W02F12.5
Simmer:W02F12.5
PCR_productsjj_W02F12.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W02F12.5 Source_evidenceePCR1056WS150 Sequence/Annotation Release
Chunk_score Abs_score993
Max_abs_score993W02F12.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV67101706711332
Overlaps_transcript W02F12.5.2 Source_evidenceePCR1056WS150 Sequence/Annotation Release
W02F12.5.1 Source_evidenceePCR1056WS150 Sequence/Annotation Release
W02F12.5.3 Source_evidenceePCR1056WS150 Sequence/Annotation Release
WB_DNA_textsjj_W02F12.51163ttccgttgactggaacaacacgatcaaacactccgtgcattcccaaaattgcactttgtggtggattgatgattggggttccgaacatggatccgaagactccaccgttagaaatcgtgaaggttcctccctccatatcttcaacagccagctttccgtcacgagccttcactccgagattggcaagttccaattcgatttgagcataattcatgctctcgacatttctcaagactggaacaacgagtcctttcggtgtagcaacagcaacggagatatcgacaaagtgacggtagacaatttcgttttcatcgagaacggcgttaacaactggagattcttgaagagcgtaggcggcagcgcggacaaatggagacatcattccgagcttaactccgtgcttggcaacaaaatccttctgataagtctttctcatttcgatgaggctgctgcaaaaacacgaaaactttttttaaaaacccagaaaacaacaaaaaacctcatatcaatctcattgaaggtagtaagcatagcataagtattctgagcatccttcagtctttgagcaatgcgcatgcgcattctgttggctttaacgcggacttcatcacgggctccggtgattgcgtgggatggatcaactccctttggaacaacgacacgagtgactgggacggctccgactggagtggaagatgatggtgttgatggtgggcgagcaactggtggagcagattttggaatatccccagaaactggctttggtggggcagcggcagtcacagctggcttcgaatcttccttggctggagctggttttgattcttctttggctggcgctgattttggttcttctttagctggcgctgactgaaaaaaaaacaaatattataattcagtcactaagctgtacaaaaattaactcacagacgagcctccgcctgctcctggctgaagtttataaagcttttgcttggctgtcactttagctccatcttccacgagaaactcgacaattgttccggcttgtggagctggtacttcaaccgaagttttatccgtctcaatctcagcgacaagttcgtcttcgttaacatgatctcccttctgctttagccatctaatatctccttccgaaattgattcagcaaaagctggtcctt