Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W03C9.3   

sjj_W03C9.3 RNAi (6)
PCR_productsjj_W03C9.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W03C9.3 Source_evidenceePCR840WS150 Sequence/Annotation Release
Chunk_score Abs_score735
Max_abs_score735W03C9.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1196538111967013
W03C9.5 Source_evidenceePCR62WS150 Sequence/Annotation Release
Overlaps_transcript W03C9.5 Source_evidenceePCR62WS150 Sequence/Annotation Release
W03C9.3.2 Source_evidenceePCR659WS150 Sequence/Annotation Release
W03C9.3.1 Source_evidenceePCR840WS150 Sequence/Annotation Release
WB_DNA_textsjj_W03C9.31633caaagggtgactaccgtaatctgtgggattttcttttcaaattttttgggatttttagaaagtggagacgagggaagaggaaatgtgtgttgtgtggattgaattgaattgaatcgaatgtgtcaaaaatacattttgtgcagatagagatagagggctctgcgcggagcagcacacggttaacaattgcatcccgaattctgctggttctgttgatttgggttgagacggatttggtcgggaaactctgggaaatcgttggtttcctgaaaaatttaaaatttttagtttgctttttgttggaaaaattcaaatttttacataaaacgcagcatatttttgatatatttatttagttttagatttttcaaattttttgaaaaaaccagttttctaaccaatttctttgatttttagcttcaaaatcgctaagttatgccattttcaaccgaaatttggcagtttttcttgatttctgcgtacttttttcacgattttaaagctattttcactatataactagtttttaattacaaaaaaatcaatttccgcccgaaatttcacattttttaatttcacaggaaaatccaatttcgccgcatttttacctgagattctctagccaacgcatcacgagcaattgccaaaaatgcggcttcaacgttgagagcttccttggcagaaacctcgtaatacggaatatttcccttcgtctggcaccaagattgagcacgttttgacgaaacggcacgctgtgactccaaatccaccttgtttccgagcaggacaaacgggaaatggtctggatcgcgggggctgcaagaatttgaagttttatagaaaaaccgtggatttttcgaattttttggagaaaaatggtggatttttccgttttattagagaaaaataatgaatttttcagtttttttacagaaaaaatgtgatttttctaaatattccccgtacctagcctgaatcagaaactcgtcacgccacgagtcaagcgatttgaacgaggcggcatttgtgacgtcaaaagccagcacacagcaatcggctccacgataaaaagcgactccgagcgattggaaacgttcctggccggctgtatcccagatctgaaatttttgtgtaaaattttgtctatttttgataatttttcacctgaagagtgacggttctgtcgtcaatgtttacgtcgcgtgtgaggaagtcggctccaatcgttgcctgaaggagaaatttgtttatatttcagggagaattttgagtttaaacaaaaatttcagtttctaaaaaaattgacaaaccttatattgattactaaatcgccgatttacatattgattcatcaaagatgtttttccaacgcccgaatctccgagaatgatcactttgagcagcgccttctttctggttcccgacatttttgttcactggaagcctttttgttgtgctgcaaaaatcaattaactgataagaaaatgaattatagattaaaaaaagaaagaaaaagatacagacaggcgattgttcaacctgtgtcgcaagaacaaatagtaactaaattgtgacgacgaaattatttagaaatattacataaagcgaaaatacaatttgacccgtagcaaaa