Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W03F11.4   

sjj_W03F11.4RNAiJA:W03F11.4
PCR_productsjj_W03F11.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW03F11.4 Source_evidenceePCR1173WS150 Sequence/Annotation Release
Overlaps_Gene W03F11.4 Source_evidenceePCR1173WS150 Sequence/Annotation Release
Chunk_score Abs_score1152
Max_abs_score1152W03F11.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI22386592239831
Overlaps_transcriptW03F11.4 Source_evidenceePCR1173WS150 Sequence/Annotation Release
WB_DNA_textsjj_W03F11.41173ctcagaactcagggcctttgcagctgcttcttgtatctcagtgaagtcccctttcaaagcatctaaggatccacgaatctgcatcaatttgttgatttgagtcaatcctctgacagccaacgccaaatcttttacagtgttctgagaatcagtgaatgaagtcttcagagccaatgcttctcgtccatcggcactcttcatagactgacccgacttttgaagaatctccaagtgttgccgagaatcagaaactattttgctgattgtttttgcactgtccaatgtagacttcgagacgtttttaatcttctgaatgacatctaaagcattagatacaactggttccttctctgtgatgttgttcaggcagtcaaagaattccgaatcactctggttaaccgttctataatgttcatcaatttcaggtaaattgttttcaaaagtcgaaataaatttggaaatgctacctatcgacccagaaagagaagcaagatctgactgaagaagcttcagatattctttggtctcgttaaacgtcggttcttctatcatctttttgataaccactcgtccatcagcagctgaagcaggtgtgatactaaggatgttcttaaatcgagacatatttgtcagagagctgagataactgaacgacggtagattcttgactgcttcatttagctggttcatcgagttgaaagcagcttccaaatgattcagattgtttgccagcattgtttttcccttatcacacaccaacatagcattgatgacttgtaccggaacagttgaatccatgactgagttggccaagaaatactgtagattcgtcacttctccaaatgatttcttcttcggttcatccgacatcggtttccaccatttttcagcaagcccaagtgcactttttaaagtatcaaaatattgaaaggcagttttcagatttttaatgaccaccgaactattaccaatcctatccgcaatccaatcttgttgaaagaccagtgacagttgttccaaatcatttgaaccaccgggtaaaccaatcgcgtaaacaagtgaaagatccactaactcggtgtgacttctaatcagcttttggagtgttttgaagacaggaagagacgacttggagatcaaaacgtactcgtcaacactcttgaagcttgcggt