Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W03F8.5   

sjj_W03F8.5 RNAi JA:W03F8.5
Simmer:W03F8.5
PCR_productsjj_W03F8.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW03F8.10 Source_evidenceePCR1030WS150 Sequence/Annotation Release
Overlaps_Gene W03F8.10 Source_evidenceePCR1129WS150 Sequence/Annotation Release
Chunk_score Abs_score1108
Max_abs_score1108W03F8.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV51803475181475
Overlaps_transcriptW03F8.10 Source_evidenceePCR1129WS150 Sequence/Annotation Release
WB_DNA_textsjj_W03F8.51129agcggaggagcactttgtaatgaatgtgccagaggatacactggacaatggccatactgtaatccatgtggagagtgcttccatcaatgggataatattatgcagaagcttcagaagcaagtgcatgctctcattgatactgctaataatattgaggatactggagttgcttcagcttatgatgcagactttgagaagatggaggaaacacttaaagagactaaaaaggctttgtctgatgctaatatttcaaaggaagatattgaggaaatgagcaagaaattggctcttttgaagaagcaagttattgctggaagagaaaagttgggagccattgaaacgagaatttcaaatataactcaagcagttgactttgctcagaaggatttggagcacttgcagaaggaggttgataaggttacaaaggcaacgattgaattggaagataaggctagcaagatcaaggaagcagatgtacttggagcatttaatattacaagagaatcagcatccaaatctctggatgcacaacgaagaactgatgcagctattggaaaacttgcagctgcagagaatcaggctctccgtgccagtgagctcttggagaaaaataaaaatgactttgagaagcaatatgttgagaatgaagaagctctcaacgaagctgaaacccttcttggaggtcttgaatctgttcttccaaaactcaatgaacaagtttgtggagcttcaagtgcaccttgcgatgctctttgtggaggtccaggttcctgtggattctgtggtggtcagtcatgtatggaaggagctgtgagcaaagcaaatcaagcgaagagctttgcaactgaagcagatactagattagatgagaagcaaaaggaagcagaagaagtattgagtattgttagagatgtgctcacagagactacaaaggcaaaggcaaaggctgaaaaggcttatgaagttgcaaagaatactgcacaaagagcaaatagctcgagagctgaacttgataaaattgctgaagagatcggagagttcttgactgcccagaagagttcaccagaacaaatccgcaatttggcagaggaagttcttggcaaggaaatcagtttgacgccagatcaga