Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W03G9.2   

sjj_W03G9.2RNAiJA:W03G9.2
PCR_productsjj_W03G9.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW03G9.2 Source_evidenceePCR1075WS150 Sequence/Annotation Release
Overlaps_Gene W03G9.2 Source_evidenceePCR1075WS150 Sequence/Annotation Release
Chunk_score Abs_score1012
Max_abs_score1012W03G9.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI49625954963780
Overlaps_transcriptW03G9.2 Source_evidenceePCR1075WS150 Sequence/Annotation Release
WB_DNA_textsjj_W03G9.21186tcagacgaagatcgatgacgcacggaagaagagccacgatgcaaagtacgcgaaagaggtggaatgggatgcaaaagatactgcaaaaggcaagccggtgttcaagaagtatcggcaagagattgccgataaaactagccgatgcgacgcccaattcatcaacaatcttcacacctactatggcaatggtagtgaattgagagagctccccgaaactcactatgccgtcgatttcatggtatagttgaatatcatccttcagagatgtggttctcaaaaaaataattccagggaaccaccatcgctaccacggaaatgaccgccgaactgaagaagttaaaggtgatatatacaacaatgaacaatcactaataaacataatttgcaggtgctcaagaagaaaacggccacatcacaattcgttcgggagcacagacagctcggattcatccctactccttcgcgaagatcgctatcttgtactggccgtttcatgaacttcgaaacgaaatgtgatgagcgcccggacagaacgaacccagaattttcggttggaaacaataatttcctgagcgcaacaatctccaatctcgacgaggatttcaaaacaccatcgaactgtgagcatgtagcctccatcgtgcccaaagagatttcaaatgcgctgactgcattgatacctcatgtgaatgttttcgattacgaaaagggagagatggaaatcggaaaagtcctctgcagcaacaaaaatcttcatgcgtatgtgatccctaaacaacacgatcaggagcaaatgctgaaagatttttccgctcgattcttggcttggtacaacaaactatcacatcttcaaagagatacgtttggaaccgacaaagaccccaaaagatcaggaaaacaagaagatgggaagccgatgaagccatatttttggagagtcaatgttattttgtgcctccaggagtttcaggaagagggtacaatgttccgaagagctcgtcatgtctgtggtattcgtcctcacaaaagtcaacccggactcgatttgtatatcgagattgacacaggaagtatgagagctctgaagacgaattatctgactgtgagaaaattgccgcaggagttcgcgaatgtcccaactccaatccttgaagttcgatttgaaggtgccaaggtgagcaatttt