Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W04A8.2   

sjj_W04A8.2RNAiJA:W04A8.2
PCR_productsjj_W04A8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW04A8.2 Source_evidenceePCR312WS150 Sequence/Annotation Release
Overlaps_Gene W04A8.2 Source_evidenceePCR312WS150 Sequence/Annotation Release
Chunk_score Abs_score270
Max_abs_score270W04A8.2
Specificity_index0.659
Rel_score1
Map_statusUnique_ePCRI1384049713841512
Y71H2AM.2 Chunk_score Abs_score62
Specificity_index0.151
Rel_score0.23
F45H10.1 Chunk_score Abs_score78
Specificity_index0.19
Rel_score0.289
Overlaps_transcriptW04A8.2 Source_evidenceePCR312WS150 Sequence/Annotation Release
WB_DNA_textsjj_W04A8.21016acacgaaatactgtgttgtgacggtacttttgagtgaaattcaatttaaaataatttttaagagttttactttgtttttctgcattaaaaatgatggaagttaaacaaaaattttctgttttaaccgttgattttttttattatgtttggtcttttcaatcttttcaaaaaacttcatcatttatttccagaaatgctctccaatcaaacgagggtgtggtgtcaccccggaaaacgtggcactatcatctgcaaaatcttcataggtaaataaattgctaaaaagaattttttccataaactttaaattttcagacaatcagcattcggagagtaccacgaaacgagagaccggaccaaaatggaagatatccaaacagatttgtcttctctgaaaacgactggattgaaggacaatccaaacggaaacaaatcgaaacttacgggttgacatcgaccagagcaacatcagctgtggtctttcaactgctcagaggaaagccttttccttgatgatggcgtatggaacgttgtactttcaacattggactggaaggtggagcacgatctcaagtgggttgacgtcatgagcgatgagaaccaattgagctcggagagtctcgacgaggctagtgatggcgttgactctactgcgacgctaaagacgaatatactttggccatttgacgaagcggataacgttcatctgaatgtccaccagcaaacttgattcttcctcggacaatcgtagcgagtggattgaccaattccactgcaactttttcctcacgagggacgaggaaaagtggtttctaggccatggccgaggggccgacaagtttcagcggccatttatcttgctttgttttccgccactctttcttggtctagtttcaagcgaagcttacaacggatcattcggaacaactccgttcaatttcaaaccatatggtgtgcaggacgttcacattgatttttgcggtcaaacagttccaggacgaccaatgaatctagac