Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W04G5.8   

sjj_W04G5.8RNAiJA:W04G5.8
PCR_productsjj_W04G5.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW04G5.8 Source_evidenceePCR759WS150 Sequence/Annotation Release
Overlaps_Gene W04G5.8 Source_evidenceePCR759WS150 Sequence/Annotation Release
Chunk_score Abs_score647
Max_abs_score647W04G5.8
Specificity_index0.836
Rel_score1
Map_statusUnique_ePCRI1164987611650971
W04G5.7 Chunk_score Abs_score127
Specificity_index0.164
Rel_score0.196
Overlaps_transcriptW04G5.8 Source_evidenceePCR759WS150 Sequence/Annotation Release
WB_DNA_textsjj_W04G5.81096tgactcatagcaaaatgactggatataaacaacaacggtataaaaagacactgcgtgaaatttcctttcattgtattttctttgatacaacaaaatggccggtaagatttttttcctaaattcctaaaaaagttttttaacattctgcgttttttccagaagtcctccccgaaatcattggtataatagacgatggtctggctattggctcattttccttctcaaaaattgccgataagctgctcgaaatcgcagcgtggggctctttcatcaaggatatgattggagttctcaacccagataagcccgatccggttatgctcaagcttatcgagcttgacaagaaaatcacgcaactttccgacaagatgtcatgggagttcgatagcctaaaggccttcatagtagaacacgagttttacgcggatctggtgcaaaccgcctcgacgttaatgaagttcatgcaggatacagtcaaggatccttgtaaggatagttatgcaattttcagagatgtgtcgcagaaatctccaccattgcagtacgcttatgtaagtgggtggactaatgacttttggtatatttttgctgcagaaaatgataagtcttttggagcaagagtcgacgaatccattaaaaatggcaatgaaagccgacccattgagaacttcggaaactttcgataagtggagaaatatcattgacggcgtgattacccaatttgtaaggttttactcagttttttaggcttttaaaattttgttagtgtaagaaaaagcgtgctccgccatagtgctgctcaaaaccacctattccagctgttcctcgagacttatatcaatggtatattctgggataagaatatgtatggcccgaagcttctgacagaacgcatcacccacctgaatgagcagatggatgcatggagggaagactatgaagtaagttcaatgtcaacctttccagatttaccgtagatattcttcaggactcttattgggatactgttgtcgagcgtatggttcatgatattcaagataggtatgagaattcgaatgctagcaacgaagagaaatcaaagatgatcgctgacaat