Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W05B5.2   

sjj_W05B5.2RNAiJA:W05B5.2
PCR_productsjj_W05B5.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW05B5.2 Source_evidenceePCR858WS150 Sequence/Annotation Release
Overlaps_Gene W05B5.2 Source_evidenceePCR858WS150 Sequence/Annotation Release
Chunk_score Abs_score732
Max_abs_score732W05B5.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1305330713055581
Overlaps_transcriptW05B5.2 Source_evidenceePCR858WS150 Sequence/Annotation Release
WB_DNA_textsjj_W05B5.22275atttaaggagcaaacggagaaacacgatggtctttgaaatgtttagaaaaaaccactgtattttttcagcgcaacgctctcaacttggtactgatgaacttggcaattgctgatcttctcatattactattctgtcttccattaacagtggtgaatgacgtcaccaagactttttggttttcggcggttttttgtaaaagtgttaattttgtaaatgtaagttttgatatcgaaatttcaattgtataaaattatcgatttttttcagaatacatcagtgtacgtgagcataatgtcattggtattcatcacttgtgaaaggtggcgagcaattacatatcccttaaaaagcccatttgttagaacgagatctgtcattggaggtaccaaatttcagcttaattctatcaaaaatcgatatttccaggaatttggttcattgcaatgttcctctcgtcgccggagcccgtcacgctacatctcgccggagccccatttgtgcgacctaattttacaacaaaggtaataaattgaaaatctttatcatttgcagcaaaattaaagccatggcctaggattttttctaggccatcaggttataaatgtgtgcaacatagtactctgaaaacctattgccctgagattttttgaacatagtgaatgaactgtggtctatccaatccaagcttgaaaaattgaaatttttaaaaaattaattttcagtggggaacacgttgcaaggaatcgtggtcagaagaattccagaaaaactatcaactactacagacaattttctcatttgtacttccacttcttgtcatatcaattttatgtctgcatatggtccgaaccttgcatttctctgcaaattacttgacgtaagtcccgtattttctataccaaaaactcaaaatttttccaaattttaaagtctaatagattttaaattttgcgcaggttatagtgtaagttgaaagttttttgatagctgtagccgtatgaatgttatgtcagttttataaaactttataaaacatttatatataaacctttcgatagtagttccaactgaaaattttggaaattacattttcaaaaattttgaaatattctcaaaaagtcaataatttcagagtagcaaaccgacaaatcagcatacgaaaaaaagcggtccggatgctatgtgcagtggtttttctcttctcaatgtctaatctacctgttcatttgtacaatattgcgctgtaagttttttgtaagattttaaatggtgaagttttttttttaattagaaaaaaacttttactaaaagcgagatatgagagttttaaaaatgggtacaattttttaaatttgttttctggatattttcaattgctcatatctcgttttgtatgagagttacaaaaaaagtcaactgacaatatatttaaaattttttgataaatgttttgtgtgttgaaatcttttcgatttttcttctcaccgcaaagatatgcaagttttaaggaagtatgttcctctagttccgtgccgaaacttccctttgaacccctgtaagaccttaacaatttgaaatattgaaaagttgtgaactaacaaaataaactacatacatttttccacagtttgttagttgacaacctatcaccactaccaagttataagagttcaaaaataaattcacctaatatttcaaaatttccagaaactacgatttactgtcaacggatgtgagcactaatacaattgcagttcggaagctcctgccacgcgttttttcatattcttcatcatgtctcaaccccattctgtacagctttctaagtggtaggtttgaattttgttcaatttatattttggaaaaaaaccaatcgataaaaccaacagatttatatataattttaaaaaatcaaacaaacgaaaaatcagaaaaaaagtgagatatgtacacgtgagatattcaattttgagatttcaactgatggggtgggtgggggttacggtaacaatgcctagaaatcaaccgggtcagaaattatgggaagggaaatgtgagaaaatcggatatttcggacccgtagaataagtacgtttgttgaatttagcgtagccgatttagtcagtggcaaaaattttagaatcctagtgcacctgggaaggaacttatgaccatttttaaactgatggcctaaaaaaaagctaggccatcaattttcaaaacggcttagttttactctcagatgacttaacggcttgataatttcagaaaatg