Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_W05H5.7_b   

sjj_W05H5.7_bSequenceTTCCACCCGGAAAATGATTA
Length20
In_sequenceSUPERLINK_CB_II
PCR_productsjj_W05H5.7