Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W06A7.5   

sjj_W06A7.5RNAiJA:W06A7.5
PCR_productsjj_W06A7.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW06A7.5 Source_evidenceePCR105WS150 Sequence/Annotation Release
Overlaps_Gene (6)
Overlaps_transcriptW06A7.5 Source_evidenceePCR211WS150 Sequence/Annotation Release
WB_DNA_textsjj_W06A7.5820tgtgctccctgatgattctaagttcagaatttacagaattactgtaattcatgtttgtttcatgtctttcaataacggtcaattttatacaagtttacatttcaaaggaacagttcagtctttgaaaaattcaaaatgactgactaggagaagaatcatcctgaagataacttttctttttatttttagatgagagaaaaagcaaaccttgttcgtacattttttttaaacaatgttagccatttgaagggacaagttttcctatgaattctttcaattacatcgaaattcttctattttaaatacaaattactcaaaagacaaaatgtcgatttacgctaaacattgcgcaggcgggatttcggaatcttgttcgttctttacatctgcaaacttgggtaagaagttggcaagacttggctaagacttgggcaagactcgggcgagggagtttacactagaattgttgaagtttggtaagacttgggcatactctgggctagaagttggcaagagttgggtaagaagctggaaagccccaaacttggggaagaagctgccgggaattgccgagtaagaactcatgacccacctaaaagagccatacaatacaaaaacattttattacaaatatgatatgatatgaattgtgttaaccaaaatttcttgtggcggttttctccgatcgatctagatgagatcctcgttggcagcttcaatgctgagtccaatccaagccattgcagtgtaggcgagagttgaagcaacaaggacggcagtgtagatggcattcatcttgaggtgttgttgggagagttat