Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W06D4.2   

sjj_W06D4.2RNAiJA:W06D4.2
PCR_productsjj_W06D4.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW06D4.2 Source_evidenceePCR753WS150 Sequence/Annotation Release
Overlaps_Gene W06D4.2 Source_evidenceePCR753WS150 Sequence/Annotation Release
Chunk_score Abs_score669
Max_abs_score669W06D4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI90562179057675
Overlaps_transcriptW06D4.2 Source_evidenceePCR753WS150 Sequence/Annotation Release
WB_DNA_textsjj_W06D4.21459cgtgaaccacgattttgatgtaaaattaaataatcattccacgtggagatgaggagatgactttgctcattacttttcatcagtagcgtcgcggttagttagtttttctgtgcttcctcattcctcgaatttacaatttcagctgaaaatcgaagaagtgcgtcttgattgagtgttgaagaaacaaaaagcaatgacggagatctctgaaagatatgtggaacagttcacgactaccattgaaacgctgcgtcgtcgtgtcattgcatattacgatggaattttttatttgggttagttactcaatttgtctctgctggtagttcttcattgaattacacaaattaattaaaaattgagagtgtaaacattacaggacgaaaagtggagaaagctgcagaacgtttgaaagaagtcgctgagccagctgcttatgatgctcgagactatgtgaatcagtcactggcagagaatagtccattggaagtgattgatacagagacgaagaatagcttggttgagatgtatcttggaatctcagtgagttttactctttattattttgtctacattataatatacttcaggtcattttgattggtttggctggaggtcaactctccggtgcatatgcattgactccacttattcaatacgtcttcgatacttctgtcgtttctctgatccttgctgcattgccagtttacatctactacagtattcgcaagaattccagtttggatgacactgaaagacgtagtattctattctcctcaactctattcttcggaatcttcagtggatatctttttggtccacgtatgctttcacttgctccaacaactattttccttccaccattcatgtttgctttgttgttcgacaatggaattcttccgacgcctttggtttctctcaatcgtcaaagtttcttcatcgcttttgcttccatcagcgtcttcattaccactttccttggtaggttttatactcacaaaatgatagttttagagaattatactttaacttcaaacaaacgtcaagtatcttacgctaaactcatgaagtttgcgcttgaaaagcttttttcgcggcaaggcaactacgaatacatcttatcccgtaggagtactgtagagctacttagtatcaatacaagtcataaatactatagcattgagctagagccttgttttaactatctaattctattacactttcaataatttcagcatcaatcgtcttgggtagtttctctattgtgatttcgctgttcaatatcgttcacgtcactggtctctacattcacttccaggttgcgcaaaattaaaaaaaaaacattatcaatgtaatgtttaggtgattatgcaatttgtgaaggacaaaaacttcctcgttggagagagtcaagcaatctacatcggtgtatcgattttgtcgcaggttctaatgttcccca