Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W06D4.3   

sjj_W06D4.3RNAiJA:W06D4.3
PCR_productsjj_W06D4.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW06D4.3 Source_evidenceePCR817WS150 Sequence/Annotation Release
Overlaps_Gene W06D4.3 Source_evidenceePCR817WS150 Sequence/Annotation Release
Chunk_score Abs_score681
Max_abs_score681W06D4.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI90587469060443
Overlaps_transcriptW06D4.3 Source_evidenceePCR817WS150 Sequence/Annotation Release
WB_DNA_textsjj_W06D4.31698ctaacagagtgtcacgccgaatcaaacatttttacacgaatcttttttggcgtccttatcagagtttaacatcaagcttcatagggtatttttaatcatttcgaaatttggaaaaaggctctttcaaagttaacatggataaaagtaagttttaaatctagactgatttgaattaattttatcaattcagaagcaaatagcaatcaaaatcaagagcaaaaaagagaaacgtcagatgctgtcgatcgagccgcaaaagctggactttttaatcgaatctacgtaactgttggacaaaaagttggtatcgtagaattgacaaagttagaaccacgatttgaggtgattagttgaatttaagataccgttttcaataagttatcgttgttaatcataaatcttggctacctcctgctaaaccaattcagtgtacagtgtggaaatcaataagtggcctagaaaatataaatgtcggccacccgtttaactacatttataaattttccaagacatctttgcaacacttgccaaagctaaagtaaaaaagctttctatatttcaactggctagcagcttttcgagagaatgtgttcgtaatttgttttgagggggtagtcacgctattaacgtaaaaatacggtgcccggtctcgaaacgaccgaaaaatcacagctacagtacctgcaagtattttgtgaaacttcacaatttttcatattttctcaataaatataacagttttcgcattagggaaatgcgatgtatttgtgggtacggtaacttcaattggaccattttcggtttttgtgtcaaaaaatgtttatttttcagagaaacattgagaagcttaccacctaccacaatataatttacaatatggtgaacgctatcgaacttcaagttcaagttgatccaaaggcaatagtaaagaatcaagttttgtgtgatcccgatgaaagtccatgggaattgcttggaggatggatcaattatatgggtacatatcattttaatggtccccaatcagtaagaataaaacatctgatagaatagtttttggtgttttcagaaaatactcgatgcctacagtattgcttgtggaaaaattggtcaaaaagagcgacagctccagaaaagaagtgagttgaaaacaattgatggttatattaaactttttaaaaattattttcagcacggtctcattgtatcaaaaagatgaggatgtacactgcagatgaaagcgttgaattgaacaatcatgtcgctcatctcaaggatcttcttattgcaattgatgattcacgacatcaagtgagattattaatttagaaatattatgagcctacctttttagctgaaatcatcaagaacaacaaaagaagttaaagcaaaaggtgaaatctaccgtaagaacattcaagctttcaattgtaccgcaaacgaagttcaagccaggttggatgaagttccaatgattgttccacatcatgagaatgaacttttgaaggtaaatggaaattcaaatgtatcgtttctcatattgtatgcacctgtatacttccaaaaacagttattttcagttttcccgtgaagtgtcgattttcaacaattctgtggaaaacttgctgaaagaagtggtcttccgtcttggatatggcaaaagaaatgacaagccaagtactcgcgccgttctaaagt