Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W06E11.2   

sjj_W06E11.2 RNAi JA:W06E11.2
Simmer:W06E11.2
PCR_productsjj_W06E11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW06E11.2 Source_evidenceePCR591WS150 Sequence/Annotation Release
Overlaps_Gene W06E11.2 Source_evidenceePCR591WS150 Sequence/Annotation Release
Chunk_score Abs_score507
Max_abs_score507W06E11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII640570641713
Overlaps_transcriptW06E11.2 Source_evidenceePCR591WS150 Sequence/Annotation Release
WB_DNA_textsjj_W06E11.21144tgtcatttactcgttgttcctcatttctccaatgtgaaatctctcaatttcgtgaagtctcttgtggtatgcaacggcgccctatcgcacttttttgtgaaacatattttttcctttttttgcagattttccaattttttttcgctaaacgcatttatttttaatatatttgtgttttataattttaaaaaatctgaaattttgcaaaattttccagtaaaatgggcaaaaaacgaaagcaccaggactcggactcagagcaatctggaaaacgggtaaaaaaagtggtaagaattgaatttcttgattacaacttttttggttttaattaaatgtattaaggaagaagccagaaatggtgtggctgacatgacgatcgatgagagctcggattttcaagttttcctcatcaaaaaaccgattggtgttagtttagaagatttggaggcgctaaaatggtcaaacgacgaggaagtgttgacgaaaaccaaattgaagacaggtgagagtattttattgagaaaaatctatgagaaatttttcagaatccggagttttccgagctattgttgcgccaaagtcgaaaaaggagcggatggtgcatattccggcgttcagggagcgggaagaagctgactcgaagaatattaaagctcgtaagcatagaattaagcttaaaagttgataaaattacccaataacaatttttttcagagagtttcgtcactggcgccatcacaattctcccgcaagaggtgaagcccaaggtactaggaggatttatttatgaagaaggcgaagaacccgttgaaggctcttcagaagtccatccaggcctgaaaaagatcaaaaagaccgcaattttggacctggaaagccgtcaacaacgtaacaaagcctatggaaccactacggaaggcgatggaaaaccgagaaaacttgcaaatattatcgaaaaaatgaattgaaatttacttgttgacacattttttgttgaatttatctttttgtttgttgatttttcgtttttttagctaaaaatgtttttttcttaatttttttctggttttttaaatcgatttttggaagttttaacatcttctgttaatatttatttgccacgtggcatttattgattgaaatt