Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W06H12.1   

sjj_W06H12.1 RNAi JA:W06H12.1
[cgc5655]:W06H12.1
PCR_productsjj_W06H12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W06H12.1 Source_evidenceePCR297WS150 Sequence/Annotation Release
Chunk_score Abs_score255
Max_abs_score255W06H12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1120626111207607
Overlaps_transcript W06H12.1.1 Source_evidenceePCR297WS150 Sequence/Annotation Release
W06H12.1.2 Source_evidenceePCR292WS150 Sequence/Annotation Release
WB_DNA_textsjj_W06H12.11347tttcgcactgtttttcaattttttctccgcttgaaattctcgaaatttgaatagaaatttgattttttgcggctaaattcttcattttttctcactacatttttcccgtaatttcccaattttattttgcatttttcacgtggtttcaggctgtccctttcggtttgatctacgttgatctacaagaaattgcatggttaagaacgtgctaatgtcacattttttgagcaaaaaaaaacccgcattttttgtagatcaaaccgtaatgggacggcctggcaacacgtgattttccaaattttctgctcccgattttccagtaatttcccttccaaaaatcgaatttttccattaattttgagctatttctataatttttaggctagaaatttgtttcgaaacgcattttttcactaaaaaatttctctaaaatttgtaattttttttcgaatttccgcagaaattacactttctccgaaatttttatgttggaattttgctcccaaaaactcaatttttgaaaaattcaaattttcaatacttccctgccatttctctaattccgtgcatttttccacctttttccaccgattttttttctaaaaacctcccttaaaatcaaaaatccggctaatttttcccaattttcagccaaaaattagactagaataccatcaaccaccacctacaccaccatcaccatcatcaagaacaaatgggaccggatacgacgtcggaacgtgttagcgaggatcttatgcaggctgtcacatgtctgaaacgtgtgatggtcggtatgaagagcaatgggacagattatgttcaggaacaggtgcggctacccgaaaatttgaagaaaaacgatcaaaaattgacgtttttaagacagtttttcggttttctcataaaattttagtccaaatcactgaaaaaatggagaaaaaaggatgaaaatggactacaaactacaacttttattagcctcaaccatacaaaagttgggctaacgaagctttgtagtttgtagtcactcgctcctccatttttttggttttttttttaattaaaaaaattcttctaactaaaaaatcaccgctttttctaaaatttcagccatttaccaatttttcaattttcagactccctccaacagcactaccgtaatatgcacacttgtcaaaatcaccggagcactggaacgatgcatcgagagcaataaagcgatgaatgatgtgctcaacgggaaaatggtgagcatttgaaaaaaattgtgcaagaatgctcaaaattgtgtgtgtgtagtttgtagtctgaacattatagtttgtagtttagcatccggtgact