Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W07E11.3   

sjj_W07E11.3 RNAi (3)
PCR_productsjj_W07E11.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS W07E11.1 Source_evidenceePCR234WS150 Sequence/Annotation Release
W07E11.3a Source_evidenceePCR321WS150 Sequence/Annotation Release
W07E11.3b Source_evidenceePCR228WS150 Sequence/Annotation Release
Overlaps_Gene W07E11.1 Source_evidenceePCR234WS150 Sequence/Annotation Release
Chunk_score Abs_score213
Specificity_index0.365
Rel_score0.576
Map_statusBottom50_percentile_ePCRX1009425910095755
W07E11.3 Source_evidenceePCR587WS150 Sequence/Annotation Release
Chunk_score Abs_score545
Max_abs_score545W07E11.3
Specificity_index0.635
Rel_score1
Map_statusBest_ePCRX1009425910095755
Overlaps_transcript W07E11.3a Source_evidenceePCR587WS150 Sequence/Annotation Release
W07E11.3b Source_evidenceePCR496WS150 Sequence/Annotation Release
W07E11.1 Source_evidenceePCR234WS150 Sequence/Annotation Release
WB_DNA_textsjj_W07E11.31497ttgaaaatagtgtgcctcgttttctgacctaatctggctaaaatctgaaattcagtgccagtagtcgtttcctttgttcgcgaagaaaacgtaagacttggttaacagatgggctattattccatgcggaacccaaccactttattcgaagttataggaaacatagtttaaaaaatgttgttgcattgaaagtacggatcaaaatataggacgagaatgggaagaaaatgttggaatatctaatatgatgttggctgagtagtggggttcaccgtgcattgaatcattgataggatggagttattggaagtcgtaatctggcagcggattgaatcgttttccgaaactgaaaataataaaataaattctatcgatctgcaagtgtattaaacatttttgtaagaagtgattctagtaagaatacatgacgtttccaaatatgtgtttgggttttaagcttgatttatgttgtttttccaaattttgaaaaaaattcggaaacttttaaactacttgatatacttcatatcatcaattatctctcatactcaccgaatgggctcgcgcggggagcgtttgccaaaacgaatgggttctccacgaagacgttttgccattgctgaagcttcgaaaattccaagagtgttgtcgttgacagctggctgggcgacagtagtaccctttaaataagctagttggccacgtaataactgatcccgactagtgggaatggggagtatccgctttggttgcacaaactggaagggacttacaatgacggcgagaaggacgaggaaaagagcagataggattccagaaacttgcatggtttgcgacaattggtttggcaacgactgacaatgagtcagacgaaagctctgtgtgcgggtgtgtacctgaaaatggagagctttttcacacgagatcgtttttggcaagagatagtaaaacgaagagcagatagaaatgtagagaaagtgggtgatgcgtgctcattagctcgtacagatcggattacaatgtgaactagcgtcaaagagcgttgggcgagagcagttgcgcaataacatctcatcatgtagaaatggtgattttgagtgaagacgtgaaagatcagactagtgaagcacgcgcaaaagtctccagaggaattaaatgaattgcaataaataagttattttaattataatcaatgtactttacaggatcgtctcaaacccggacgcatgctccttgtggacacacatctcaaaaagatcgagctcgatgaggaccttaagacaagaattgctttgtcaagacctcataagcaactttccgcatcgagaatctacttggacttgattcgcaaggatgatgtggttagtagtaaaagacaaaaaaaaaattgaattgtgacaaattttaactaatttttagctctctcacggtgccgtcaccaatgaataccttaatcgtcttcatttggagcaggtgaaccctggtcttatgaagaaa