Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W07E6.4   

sjj_W07E6.4 RNAi JA:W07E6.4
Simmer:W07E6.4
PCR_productsjj_W07E6.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W07E6.4 Source_evidenceePCR728WS150 Sequence/Annotation Release
Chunk_score Abs_score665
Max_abs_score665W07E6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII485044486139
Overlaps_transcript W07E6.4.1 Source_evidenceePCR728WS150 Sequence/Annotation Release
W07E6.4.2 Source_evidenceePCR728WS150 Sequence/Annotation Release
WB_DNA_textsjj_W07E6.41096cgcaaaaactagggcaaatcgatattttccaaaaataagcaatacattttcaattttcagcaatcgtcgacaaaaccgcccgtttcgctgcaaaaaatggagtggactttgagaataaaatccgcgaaaaggaggcgaaaaacccgaaattcaactttctctccatcacagacccataccatgcctactacaaaaagatggtctacgatttctcagaaggccgagttgaggctccgaaagtaccgcaagcagtgaaagagcacgtgaaaaaggctgaatttgtgccttcagctccaccgccggcctacgagttctcagcggatccatccacgattaacgcctatgatttgtaagttttttagaacttctagaactaaaattagatgaaaaagctatttttaacctaaaatgaagtgaaaaccttataaattgcagagatttgatccgactcgttgctctgttcgttgcacgaaatggccgtcaatttctgactcaattgatgacacgagaagccagaaattatcaattcgactttttgaaaccggctcattgcaactttacatacttcacaaagctcgttgatcaatatcagaaggtaaaaatcaagaaaatctgcgtatttctaagaatttttaaaaaaatctagatttttcggttgaaaactcaaaaaaaatccagctttttcggtagaaaactcaaaaaaaaaacattttgataactttttcactattttcagtttaaagatggcggaaaagtgagctttataacttttatttgaaatttttaagctaaaagttgctaaaatatcagttttcaggttctggtgccctctaccaacgtagttgcccaactccaagacgatgctaccaacaaaaaacgtctcatagaagatatcaattatcgtgtatcctgggaaaaacatcaaaaaggtctaaaagatcgcgaggaggcagaagccgagaaagagcgtcaagcctatgcatcaatcgattggcatgactttgtagttgttcagactgtagatttccagccaggagatacttctcagcttccaccactatgcacaccaaaggacgttggagcccgtattcttttg