Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W09C5.2   

sjj_W09C5.2 RNAi JA:W09C5.2
Simmer:W09C5.2:Screen_A
Simmer:W09C5.2:Screen_B
PCR_productsjj_W09C5.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W09C5.2 Source_evidenceePCR917WS150 Sequence/Annotation Release
Chunk_score Abs_score854
Max_abs_score854W09C5.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1363163513633333
Overlaps_transcript W09C5.2.2 Source_evidenceePCR839WS150 Sequence/Annotation Release
W09C5.2.1 Source_evidenceePCR917WS150 Sequence/Annotation Release
WB_DNA_textsjj_W09C5.21699agcatcttcatggacgtgttaatatagttccagttatttcaaaagctgattgtttgacacgtgatgagcttctccgtttcaagaaacaaattgtcaaggatgcggagacggcggagattaagctgtacaagttcccagagctcgaggatccatatacggataaagttgcaattgaaaaacttcgaaaagcacttccattcgcaattattggctcgaatatgttgaaggaaaaggatggaaaaaagattagatatcgagaatatccatggggaactgttgaagttgagaatatgcaacataatgattttctaacacttcgtgatatgattattcgaactaatttgattgatatgattgatgttacacgtaatgttcattatgagaatttccgattccgtcaaatggagggtttgccgaagaatgagaagaatcggtgaggctcatagactacaaagactacaatttttgggggtttttttcagtgatccattcactcatcttgaggaggagagacgtcagaaggagcaagatttggatgagaagcggaatacgttggagaaggtacaaactacaactcagactacaaactacactctaaaatcgaaaatgtgtgccacgtggctcatgtaggctacaaactacaaccttctttcagcctcaatcgaatattcttccaaaaactgtttaatttagaaaaatttgaatgcctcgcaactttcttcactacaaactacaaactttttagagcctcaaccaaatttcatattttccctctaaaaagccacgtggattctcctagactacaaactacgcagtttgaacaagtatccacgtggatttgtgacagctttagactacaaactacaattttcgttgggcctcaaccaactacaaactacaaattttttttcataattttacaaaaaaaagtccatttggaagaacaagttctgttaaaccagttattcacgtggatgattagactacaaactacaaaatttggtttagcctcactcaattgatttttaaacccaaactataaactacaaaagtattaagcttatttccaagaaagactacaaactacacattttagcctcaaccaattgtgaatatcttcaatttttgcccgaaataagactacaaactacacattttagcctcaaccaattttgaatatcttcaagttttgcccgaaataagactacaaactacacattttagcctcaaccaattgtgaatatcttcaatttttgcccgaaaagactacaaactacaaatttttctttttcaggtattcactgagaaaacgtctgctcgtaagaagcgaagtgatgagagaatgtctgctctcgaagagctcgaacaacaaaataagcagaaaatcgatgcgaaacgtgcagaaatcattcgtctccgccacgagattagtgaacttaaaaatggaaatctgacgtcatcacagacatcgttggctatgtacaatgagaataatcactcgcagaattccacgttgaactccaccacaaaatcgagtcccccgccgacgagtgccacgtcatcatcgtctggaacaatgaagaaacgaatgggcggtctcggattgtttaatcgaaactaattccctcattttttaaacgaaaattcgaattaatttaaatttaaccctttctaactacaattttccccgttgtaaatg