Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W10C8.4   

sjj_W10C8.4RNAiJA:W10C8.4
PCR_productsjj_W10C8.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS W10C8.4a Source_evidenceePCR521WS150 Sequence/Annotation Release
W10C8.4b Source_evidenceePCR126WS150 Sequence/Annotation Release
Overlaps_Gene W10C8.4 Source_evidenceePCR560WS150 Sequence/Annotation Release
Chunk_score Abs_score497
Max_abs_score497W10C8.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI28520782853594
Overlaps_transcript W10C8.4b Source_evidenceePCR560WS150 Sequence/Annotation Release
W10C8.4a Source_evidenceePCR521WS150 Sequence/Annotation Release
WB_DNA_textsjj_W10C8.41517gaagagactcaaaagtctggcaaaaagttcggagcctctcgaaatgagccagatagaagctatcgtagcactgctgacaccgagttagaaactcgacgacagcgatgtcagcccatgaatatcgatctccaatcatgaacttttgctcgccgagcaactcttcatattctctgagcaatgggaagagtgactcctctttgaatacattccagcattctttctgaaaaggaagtattgaattttatgaggctatctacctgcctgactaccgcctatttccatgcgcagtaggcacatgtgtagacataggcaggcattatcgcgcctcccttcaaactacctactaggtactaggtagttcgaaaggagacgcgataatgcctgcctatacctacacacgttcctactgcacatggaaataggcggcaggcaggcaggtggatagcttcaaggtagtgcctaccctcgcgtcatagttcttcgtcagtgttgctctcaaaattgggttcatcgctgtgttgagctcctcgagtttttgaatcactttatcaacttcttcctgatccccacttgagcttccgtacagacctgaatttttttttcaaaatttggctttcaaaaatgaaacgatattaatctcaactttttggaaaatattaaaattgaaaaaatgtgcaagttattgtaagctcaagtgtttgcacattttcaaaactacagtaaccgagtgagatatggcacgcccacaaaaccgtgccacactattttgcaatctgcgcacggttttgaaatatatttttgcgagggcaccattttatgggcgtgaccaaaaccaaaattcggggtttttcgtgttgcaaaaaatgcgattttgcgaaggcacggttttgtgggcgtttttgaaacgacttttaaaaaatctacgaaatttcttttgaaatctcaaaaaaacacgtgaattcaggctgtcccgacgccccactgcacatttgtttgtgacgtcacagctcatttcgaataactttcgtgtgcagtgatgtaactacctgacaccacgtgtaaaaaagcagtagtcactaaccatattgaagagcgatatgtctgcaaatatcgataactccaataatagtccgtgtatcattaatcttcatcactgggagttttgtgtcatcattgaaacctgctgcaaagaaaaaaaagattttattggtttttgtgaccaattcctgcgattttacccatttttcgtttggctttccactgggcaagtgtcaatcgggtgtccgtgaactttctgtgtgtgaataccaatctaggaatgattcaagatatatatatatataggctgtgaaagacatggttcatcgatcttttacagttttgtaattacagtactctttaaaatggcacgtatttttacattcaagaaaaatgtaccgggcttttttggagctttaatttttagaggaataatcgtaatttttaacattcatagaactcttttgttccgtcaagaa