Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y102A5C.1   

sjj_Y102A5C.1 RNAi JA:Y102A5C.1
PF:GL1_1C1
PCR_productsjj_Y102A5C.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY102A5C.1 Source_evidenceePCR984WS150 Sequence/Annotation Release
Overlaps_Gene Y102A5C.1 Source_evidenceePCR984WS150 Sequence/Annotation Release
Chunk_score Abs_score921
Max_abs_score921Y102A5C.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1691993416921021
Overlaps_transcriptY102A5C.1 Source_evidenceePCR984WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y102A5C.11088ctgccgtatcccttcatcatctcccatgtactgaattccaaaatttgccgccagttcttcaagatcgaaggaattcatgacttgcagcgtgcagtggcggaagttcgaggattctaggagcctctgaaaatattgaattttctaattttctaataaattttttttgtaaaaactgacctccttgacgtcctgaaagcacaagtgctcgaagaacagctcaaaatgctcgaaatgcagaaaattctcaatgggaattttaacgagactatcaatttccagatgtttcgcctgtttccactgatccaactcgacgatttccttcattatttcgatattttcaaaggatgaagagtcacaattcgtcacgattttctcgagaacaccacttttcagataaggaataatattcttcgcatggttcatctcgtacccactattcgtctctatattcacatttttcactggaagcggcaaatttcgggccttcagcaaggcctccaagcttttgaagcatttatccgagtctatatctaatccgtgcttcgcatcaatcaatacttcaaagtaatccagcttcaatctaggatttatcaaagtgacgccgaaatcgaaaagtgcgatatcgattttatcgtcgtggccttcctcttccagatctttatacttgacgcaagaatcgtcatattgaagaaatacagtatcatcgtagaatccaaacgacaaactcttcggcatcttgctttcctcgtcgacaatggatctgaaggcacgggagacttgtctcatcgataatctggaaattttacatttttagatgaattaaaatgtattttcaatgatcaccttgaaacccaatccaattcattcataattttcactaaaatttcgatagggatattgaaaatcgacagggaagaacttttgtcaaagttgaaatccaaattcaaatttccattggcaaatctcatgaaccaaaattcaaagtcaacgtaatccatacacgaatctcctatcacatcgcagaagcttttatacgcttcaaaaactggttttccgtcgataaactcgtaaagaacgcattgtcgcag