Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y105E8B.f   

sjj_Y105E8B.fRNAiJA:Y105E8B.f
PCR_productsjj_Y105E8B.f
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY105E8B.9 Source_evidenceePCR1042WS150 Sequence/Annotation Release
Overlaps_Gene Y105E8B.9 Source_evidenceePCR1042WS150 Sequence/Annotation Release
Chunk_score Abs_score979
Max_abs_score979Y105E8B.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1468020614682679
Overlaps_transcriptY105E8B.9 Source_evidenceePCR1042WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y105E8B.f2474ggagatcaaacaattcagcaaaggtgcaaagtcatgccgaatttctaatgtttttaaaatgtttctacactgactggcaatattcagattatctactagagcaggccaaacttacctataatctcgaaatcctcgtgcattccaaatccaagacaataaaacggcttcgagttgatgaaaatctgcgagtctgaccatgtaacagtacggaatccaaattgttccctatagatatctgccaattctccatcaagaatcaatgatacttcaagagaataaagatccggttttcccattccacgtggccaccataactttggattagatatctgtccctcactctttgtctgatttccagtgtaaactagagatccttctccatcgaacatcttgacttcaacacgtactccatctaaactactgaccgctgtctcgaagaagaatgatccagtgtgatctgctactatattgatattttgaatatagactgaagggatcttcatcagttggacacttctcaggattccggcgtagttgaaaaagtcaaagtttccgacgttctttacggcgcctgctgggagacgggagagctggaattttgaaagattaaaaaagtcgagatttggtgtaaaatacaatacccttacagtacctcaaattaagtaatttatttttcggtaggtaaaactaaaaagggacagtagtgatactctatgaaactacgaagatgcagtgagggtactgtgtgggtaggtattatatgggtactgtacagatacagatacaaaatagacatagtatgtaggggtactgtagatggtacttgtgtattatttcccctcattttttgaaataaatttttaaataaaaacgtgtggagttgttgtatttttaggctttggaaataaccattttctaagcctaaagatggaaaatggacatcatgttttattaaaatggataatattaaaatgaggggaaataatacacaagtaccctgtagatacgctttggggaactggacgcatactataagtgcagttttagggtattctagggtactgtagattaactggatgggtttatatcctaaagttgctactatactgtaggggtcctgtaagcgtatgtatgtatatgataagggattgtaggaatatagttgtaccgacgcggtacgttagaggtactgtgtgggtaggtattttagggtgctgtcaaggtactgtaagggtactgtactatactttataggtaggttattgcatgtgtactgtaggagtactgccagtttttatagggacaggcacgttcggtattgtaggagtaggcaaggaaagtactgtatcgctaggtatggtaggtaactcacaattctcccgctgatattcctcggagcaacactttgataattaaagtccccctgaggaattgttgaccatgacagagtattattaacggccacggtgaacttattctcggctccaaactttatctgtgcagaaatatcaacttcaaatggcaaatgtcctccgatatgagaagtgaccttttccgagttgatgtactgaaaaatcaatatttttttcaaattagtacatcctctctaccataccactactgcaaaatagttgaccgagccgaatcgcagcacgtgcctcatattacgatctctcagcggaacgaattccttcttctcgtaccaaacccatccgatatgatctcgaagttcacttcctgttcctaaatcgttataggcagatggcacgggcatcactgtcgcgttctggaattttttttttgaatttttaaaaaccttctacactctctctctctttctacacatagataatcaatttttaagcctttttccatgttaaatcaagtttctaccttttcttctcgctgagatacacaccgctttaaagttttgaaggtgagagtgtgtggggggaggggagagcacagagagaaagagtatctgcactctctcaccccgctttacctaaaaacgctcataactcagcggagagcaaagataacaaaaagtttccaactaacaaaatgtagagaattttaagggctatatttaatattgtgataatttttcaatcacatcgaacttcaggaagataaccaacctggaacctctccaaatccaatgtattccactgattaacaattccaacatctcctccattatgtggttccctaacaaatgtccaaagaccatccaacgagtcgacggttcttatctcattcttctgtacgtgaagaaggcatgttattgtggaaatcgattggaggagcagtaataataataccgtaggtttgagtatcattctgtaaattgtgtatttgattggaagatttgttaagattattaatgagtgataagagagttgagtgcaaaatgtacaatagcgataaatttaagagatgtgtacgtaaggagaacttctgaagggtttgat