Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y105E8C.n   

sjj_Y105E8C.n RNAi JA:Y105E8C.n
Simmer:Y105E8C.n:Screen_A
Simmer:Y105E8C.n:Screen_B
PCR_productsjj_Y105E8C.n
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY105E8A.9 Source_evidenceePCR1024WS150 Sequence/Annotation Release
Overlaps_Gene Y105E8A.9 (3)
Overlaps_transcriptY105E8A.9 Source_evidenceePCR1039WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y105E8C.n2128gcagtgttgtcactgatttttcagctttttctagtggattttcgtgattttttgattaaaaaattcattttttcactaataagcgtcgtttatttcacttattccacttactttcactgctgagctgtaaaaaaaactaaaaaactccaaaaaaaacgtcaaaaaatgaggaatttttgcagggtgaggctccaaggatggcgacggctgtcgagctagccattgagaagatcgatgagtataagtcgaagattggaaggtttgtaacattaaaaaactcaaatttttgcgaaatttccccagtaaattctattttttcagaactctcggcactccgatgcggcttcgagacctaattcggcaggtcagagcggcacgaacgatggctgaagagcgagcagtggtggatagagaaagtgcgaatattcgagaaagcttccgagacgatgattctccgtggaaatgtagaaatatcgcgaaattgctctatattcatatgctcggctacccagcgcattttggacaggttattgaaccgtttttcgccggaaattaaattatttgttattcagatggagtgcatgaaactggtggctcacccccgattcactgacaaacgaattgggtatcttggagctatgcttcttctcgatgaacgatcggaagttcatatgctcgtcactaattcgcttaaaaagttagcaaaaacccatgaaaatgaaaaaatcttgtttaaaagctttttttctgcgatttttctcatcaaaatttgattttttgaagaaaaagcaatttttaaaggattttcaatgcaaaaatgagattttacagtaaaaaatgctatagaaaacaaaaaaatccgaagaattattattttggttgaggcgtagactacaaactacaacttttttagcctcaaccagcagctttggggaggctgacaaaagttgtagtttgtagcctaagcctcaaccaagatttttaacttgattttgctcatttttagtgatttttcatcaatttttactatttttcgagctaaaattagtgaatttggttctaaaaactggaatttttgctttaaaattcacgattttgctagaaatccaaatataaaacgatttcttccaactttggtgaggctgacagaaagttgtagtttgtagtcttagcctcaactaatattttgctcattttcaatgtttttcatcgaattttcactatttttcgacgaaataatagagaaattggttgtaaaatccggaaattgagcaaaaaaggtgaaaattttgctaaaaatccaaattttaaacgatttgttttccaatttggtgaggctgacagaagttgtagtttgtagcctgagcctcaactaatattttgctcattttcaatgtttttcatcgaattttcactatttttcgatacaataaaagcaaaaaatcccaatttccgcggaaaactctattttttaaaactaaattcttcatttccagcgacctcacctgttccacccaattcgtcagcggactagctctctgcactctgggctcaatttgctcagcggaaatgtgtcgagacctggccaacgaggttgagaagatcatcaagcagaacaatgcgtatttaaagaaaaaagcggcgctctgtgcgttccgtatcgttcgaaaagtgccggagctgatggaagtcttcattccatgtacccgatcgcttctgggagagaaaaatcacggagttttgatgggcgcaacgactttggtcacagaaatgtgcgagaaatctccggatgtcttgaatcattttaagaaattggtgccgaatttggtacggattctaaagaatcttctaatgagtggatattcgccggaacacgacgtcaccggcatctctgacccgttccttcaggtcaaaattctgagattattgagagttttggggaaggatgacgtacgtgtcactgaagagatgaatgatattctggcgcaagtggcaacgaatacggaaacggcgaaaaatgtcggaaacgcgattctctatgagactgtactcacgattatggagattaagagcgagagtggcctgcgcattttggctgtgaacattcttggacgattccttttgaata