Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y106G6A.b   

sjj_Y106G6A.bRNAiJA:Y106G6A.b
PCR_productsjj_Y106G6A.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY106G6A.5 Source_evidenceePCR633WS150 Sequence/Annotation Release
Overlaps_Gene Y106G6A.5 Source_evidenceePCR646WS150 Sequence/Annotation Release
Chunk_score Abs_score562
Max_abs_score562Y106G6A.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI99346939936088
Overlaps_transcriptY106G6A.5 Source_evidenceePCR646WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y106G6A.b1396acatggaaagtacaaggcttcaaaataaggcgatgggtcagtcagaacaataaataaagcaaatattgcgataatatgcgttacgtacagaacgaaatggttctattgcatgaggaaaagataagtaaaagtgggcgggaagaatgttggtttgaccaaattgaaatgaggaatcacaggaaaagttatgaaatcatggaagctgcatgtttttggaagaaagaaactcctcgagcatcacttcttcttgctgagccttaacggcatcttcaggacgagaacggagtgcagctgaaagttttatgattcaaaataggaaaaaactatttaaacactcaatcactcacaagtcaaaacgctgggagattcacactcgatttgcacaatagtagctgctgatttggcttgttgtcggattaaatcaacttctccttcagtatgagcaacttcgcacagagcttccaaatacgtcatcgcctgttcagtttggttgcagaaacgcgtgagtttcgaaatttgagcgttgatttctcgaatcttcttgtcaaattctacagaatttcggaggaactcatcaatttccataaccgcatcggccttttctttacacatttgctggcatcttcccattcgagtactacaaagattcgctaaacgacccccttcggctccattttcctctacttcggtgataagattttgaaaactgaaaagatatcatgataaccttctattattaagattcccgagattggtaacatacttttgaagcaactcatttccagctgatgtgttcaaaatttcattgacggattcggtagacactctggaaagaaaatgcatttttttcaattgcaaatttttttggatagaaaactcactcagaactccaaaaattcattttaaaacgtagtttttgatataaatattagagaatttgtttcgaaactatcgaaaaattctcagttttgaaatgaaacaacgtcataaaaatacaattgcatggtttatgctaattcaagtgactgtttgtgcgtatgtatactttgaagaggaatattgaacctagaattgtgtataagtgtaggtgaatactaatggggatcgaaatcggaaaattatttgtgaaattacaataagaactttaattttcgatcaaatttacaattattttcatttttcaagattaaaacttacttttgttgagcaacaatgttcgccgaaacattcattctaagtttctctacacctgtgctcaactctgcttgaacactgctcaatgtgtcccttaatgtgttaagcatgtccattttgtattctgaaaatatatacccgaatatttgaaagtgaaaattgaattaaaaatataattcggcaaaatcaaaccgattaactt