Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y106G6D.3   

sjj_Y106G6D.3RNAiJA:Y106G6D.3
PCR_productsjj_Y106G6D.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY106G6D.3 Source_evidenceePCR1008WS150 Sequence/Annotation Release
Overlaps_Gene Y106G6D.3 Source_evidenceePCR1008WS150 Sequence/Annotation Release
Chunk_score Abs_score945
Max_abs_score945Y106G6D.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1011276910113943
Overlaps_transcriptY106G6D.3 Source_evidenceePCR1008WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y106G6D.31175aggcacgtacacctgaaaccatgcatgccttccacggaaactcagcaatcacaatagtctcacctttgccgacccatccttcaatttgttctcctttggcgctctcaatgatttttgagaagcagagcgtctgacattttgagcataacgtgcttcactcgaacattgacccttttgacaacctttctcattgcactggaaacggtctgaatttgcatttggagactgaaataatctgattcaattgaaactttattactagaatttggcttaccaccaatagcttaggctccattctcttgagtgcatctgctctcaatttgctcattccacgacttgagtcaattttctgcgatgttacacttgaacgagagctttttggttcactgtctttcaggattcggctactttttgctgtttccaaattctcatcagtcgatcttttgcttctcttactcatcttacttgacttcttactcggcacttcttcattctttttgactttcttggtctttcgagctttcacgttttgatcctcttttgctctccttcttcttctccaattctctaactttctcatctgttgatcttttctttctattgctcttcgaactattaaccggggcttcagcttcgcgatcatcctcaggatcagaacgattgtcttgctcagcactcttcttcttttcagacttttgctgcttcttgctctttctggaactatccttcttgctttgctgcgatttttctttcatatcttttgatttatctcttgagctagaacgtcttgatccttcttcattattgtctctaacactcttcttctttttcagtgaccgatctctatcatcataatcaactggcggaatgaaaagtggttcagagtacttatgacttttctcttgagaactacgacgactatttttatcttttgaaatctttcgtttagaatcatctctattactcttctccaaattccttttagatccacttttcttgattcttgagctgtcactgtccctctctcgatcccttttaatcgattttttagatcttgcaattctcttcgaccgttcctttttacgtcgttcactctcacgcttctttcttttacttctctgactttttctgctcttttcctttctcaacttcttcttccgtctcgaactcgactt