Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y17G9B.h   

sjj_Y17G9B.hRNAiSimmer:Y17G9B.h
PCR_productsjj_Y17G9B.h
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY17G9B.3 Source_evidenceePCR1536WS150 Sequence/Annotation Release
Overlaps_Gene Y17G9B.3 Source_evidenceePCR1536WS150 Sequence/Annotation Release
Chunk_score Abs_score1410
Max_abs_score1410Y17G9B.3
Specificity_index0.768
Rel_score1
Map_statusUnique_ePCRIV47609784763162
H02I12.8 Chunk_score Abs_score226
Specificity_index0.123
Rel_score0.16
Y62E10A.15 Chunk_score Abs_score78
Specificity_index0.042
Rel_score0.055
C01F6.3 Chunk_score Abs_score122
Specificity_index0.066
Rel_score0.087
Overlaps_transcriptY17G9B.3 Source_evidenceePCR1536WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y17G9B.h2185caattttcctcaagttttcaacgctttttgctcgtttttttcgctcaaataaattatttcagaaggttttgcaatgggggttatcatccccgctgtacttctcgcttcggcgacgataatcgcttggcttctctacaaacacttgagaatgcgtcaagctttgaaggtttgatttcaaaattcatttgaagataatttaaataaattttcagcatctcaatcaaccacgttcatatccaatcgtcggtcacggactggtcaccaagccagatccagagggattcatgaaccaagtaattggaatgggatatttatatccagatccacgtatgtgtcttttgtggattggtccgttcccttgcctgatgctctactccgccgatctcgtggaaccaattttctcgtcgacgaaacatctgaacaaaggtttcgcatacgttttgcttgagccatggcttggaatcagtattttgacaagccagaaggaacaatggcgtccaaagcgaaaactcttgacacccaccttccattatgatattctgaaggattttttgccgattttcaacgagcaatcaaagattttggttcagaaaatgtgttccctcggagcagagtgagaatttcaatttataacgctttcaaatattcattttcagggaagaagttgatgttctctccgttataaccttgtgcactcttgatatcatttgtgaaacttccatgggcaaagctatcggtgctcaactcgcggaggttcgagaaattcttcaatcgcaacatttctaaacgtttttttttcagaataacgagtatgtatgggcggtgcacacaatcaacaagctgatctcaaagcgaacaaataatccgttaatgtggaattcgtttatttacaatttgtacgatagttttatcattaaaaaggtcaattcaattttatttttcagaacagaagacggacgaacgcatgaaaaatgtcttcgtattctacatgatttcacgaagaaagtaattgtcgagagaaaagaagcgctacaggagaatgattataagatggaaggtcgtctcgcatttttagatcttcttctcgaaatggtgaaaagtggacaaatggacgaaacagatgttcaggcagaagttgacacattcatgtttgaaggccacgatacaacatctacaggactaatgtgggcaatacatcttctgggaaatcatcctgaagttcagagaaaagttcaagcggaattggatgaagtgatgggcgatgatgaggacgtgactattgaacatctctccagaatgaaatatctcgaatgtgcactaaaagaagctctccgattgttcccatctgttccaattattacaagagaattgagtgatgatcaagtgattggaggtgttaatattccaaaaggagtcacttttctgctcaacctgtaccttgttcatcgtgatccttcgcaatggaaggatcctgatgtattcgatccggatcgtttccttcctgaaaattcaattgctcgcaagtctttcgccttcattccattctcagctggaagtcgtaactgcattggccaacgttttgcactcatggaggagaaggtcatcatggctcatttgttgagaaatttcaatgtaaaagctgtcgagttgatgcatgaggtgaaacattgaaaattaaaattgataaattaaattctaactgaaaattgttcaggttcgtccgaaaatggagattatcgttcgcccagtcactccaattcacatgaagcttaccagacgccgtccaatcgtctctccataatttcaaaatagccaattttattcttgatgattatatatttttaatgcatgataaattttaattttcatactttaccttgcaaatgtgatgaacaaattcttatttcggggagtgaactattcctggaacaaaaacgatttgattttttaagctctataggctctacactaaattctgtgaatacgtactgcaaatatatcaaaactaaatttttctcattgcaaaaagtctgaatttattgatttttgaatgaagttatagctagtaatattgattctcatggaacagctcatattgacaaatgtgacaaattttgatacggtatttttaaaggcgcagcaaaaaattttctctatggtcccgcaacgtacacagtttcactag