Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y18H1A_67.i   

sjj_Y18H1A_67.iRNAiJA:Y18H1A_67.i
PCR_productsjj_Y18H1A_67.i
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY18H1A.8 Source_evidenceePCR243WS150 Sequence/Annotation Release
Overlaps_Gene Y18H1A.8 Source_evidenceePCR243WS150 Sequence/Annotation Release
Chunk_score Abs_score201
Max_abs_score201Y18H1A.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI758699759541
Overlaps_transcriptY18H1A.8 Source_evidenceePCR243WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y18H1A_67.i843tttaattcgatttggagcagtgtataaattcaaagtttcctcccttaacagccattcaaatgcacttttttcttcgtttagtttttcttatatatggcctccaggctctcaccaagttccgttttaccggagagtttaagtgcaaacataaattcctgagatcccatgttgtagtttatgaagacgatgaggtgttgtgagtagaaatgaaaaatgagaaatgttgtatttaatattataaattgtttcagcgacaacgttatcagtaaacaccattacgtgttccatacaaatgcaccacatatgtatctcgttgaggctgaagataccaatgacggattgccaaagtttttggatgtattactttttaatttcccgctttttctctagtatttctcagaaaatttgaatttcccgccaaaattttttatcagaaaatttgaatttcccaccaaaattttttatcagaagatttgaatttcccaccaaaattttttctcagaaaatttgaatttcccaccaaaattttttctcagaaaacttgaaattcccgccaaaaactttttctcagaattttgaaattcccgctaaaaaatgtttctcagaaaatttgaaattcccgctaaaaaatttttctcagaaaattaaaaatccccgccaaaactttttctcagagaatttgaatttgccgccaaaaaattgttttctcataaaatctgaatttcccaccaaaattttttctcagaaaatttgaaattcccgctaaaaaatttttctcagaaaatttgaatttcccgccaaaaaattgttttctcataaaatctgaatttcccaccaaaattt