Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y18H1A_68.a   

sjj_Y18H1A_68.aRNAiJA:Y18H1A_68.a
PCR_productsjj_Y18H1A_68.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY18H1A.1 Source_evidenceePCR1112WS150 Sequence/Annotation Release
Overlaps_Gene (7)
Overlaps_transcriptY18H1A.1 Source_evidenceePCR1123WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y18H1A_68.a2467ctggagcagtcacttctacgattcctgctctcatgtccactgaaaacgcgtttcagccacccaaagaccttatctcgggaagaaagccaaaaggtgctccgaacttgtctggcagcgttccactttcacacaagagctcactgactggaggtgcagataagtgggttggagaagccgtggcaaagaattggatggattcgatcggttagcatccttttttttttgattggaggccccggcggcgtaaaaatcgtgccagagttgcaagagtgggcgtttttttttgtttttctgttgttggtggggccttattattatttggtcgatggtgattttactttactggtggaaatccgctaataaaactaaaaacatcgggatataaataaaaacccaactttaaaaagcgaaccaatcagcagtttgctccgcccactattcaaccaatccaatgattggttcgaaattgggtactcattttagagggaattcaaacggaagattagcaagttcggttattgtttcattagaatatcattgcttatatatatatttaaaaaatagtgtacgtcatcaatgggcggagcctctcccatcgtggtgagacccatcgtggtgagacacatcgtggtgagacccatcgtggtgagacccttcgtggtgagacccttcgtggtgagacccatagtggtgagacccatcgaggtgagacccttcgtggtgagacccatcgtggtgagacccatcgaggtgagacccttcgtggtgagacccatcgtggtgagacccccattaattttggcgtgaaattcaaattttctaagaacaattttttggctttttttttaaagaaaaatctggaaaattctagcatttttttagaataatctggaaatttcttgaactttctagctaaatctggaaacttctagaatttcctaaaataatctggagacttctaaaaaagatcaggaaatttctagaacttttttagaatcttctgaaaacatctttctagagtatactaaaaacttctagaattttcataaaattccgcgaagctcgaggaagagatttgttcaaacaatttaatgtggagccagtcggagcacgcgctttgcgcgtgcgaacggctggttttagatattttgtagtatttttcaaatcttaaattttcagacacagcagaggtgaaaaaggaatacgataaactgcaatcacagaaaatcgatgtggagaaggactgtaaaacctggaaatccaacccaaaatttaaccaatcggaagactttcctgccttggactccaatctcgtgaaacttggcaaagactatgtgaacatcagtcttgtagatgttccattgggaagaaatgttcatctcggtcaagctccggtcacgaatacggaagaaacattctggaaagctgtgttcgacaagcgaatcactcacattgatctactcgtcggcgatgaaaccatcgaattcttccctaaaaaggcagaagattatacaaattatggtcagatgtggatcaataaccgccgtgtcgagtatgtcaatgacgatgtgtaccgatttgcaattgaagtagtgccccacggatgctccaactcgatcatctgcaatgtgactgttatcagcaattggaaagtggacactgtgcctttgaaacaagcaatcgccatcaaagaggcacttggtctaaactacttcttgctgaaagcacccgctgacgagcatgcgatgatcgtctcaccacgtggagctggacgagctggctactttttggcacttgcggttgcagtcaacacaattgatacaaagcttgccgaaccatgtattgcggatattgtcaaatcgattcgctcccagagaccaagagccgtggattcattttgtcagtactgctccctgtacatttcgttgctctacttcatcaaggtattggtttttgaattcttgtaaaatgagagaataattctcaaatttacagaagaaagtgacaaaaccagcagaaggggataaaaagccaacactgagcaacaaatacatctacaagaagtcggttgagttgaccaagcaattcaccgttctccttctcgaagcgagtcagcaaagtgtgatgggacctggatagttcttctccattttgaatatggaaaagcatttgaagtgatctgggtttgaaaatgaagaattttataaaccctggattatttccgaaatcttgcttcctgcctgctgtctcattgcggcttgatctgcaaaaaaagcggtaatatctcccccaggaaaatgtgacgtcagcacactcttaaccatgcgaacttagttgaaacgtctgcgtctcttctcccgcatttttcgaagatcacaccaaaatgggatactttgacaacacgtgcctgccatcgcttcctgaccggggattttgttagaaaattcgtggaaaataggaagaaaca