Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_Y19D2B.1_b   

sjj_Y19D2B.1_bSequenceTTTGAAGGAGCACTTTCTGTAGG
In_sequenceY19D2B
PCR_product sjj_Y19D2B.1
smd_1Y19D2B.1