Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y25C1A.12   

sjj_Y25C1A.12RNAiJA:Y25C1A.12
PCR_productsjj_Y25C1A.12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY25C1A.12 Source_evidenceePCR859WS150 Sequence/Annotation Release
Overlaps_Gene Y25C1A.12 Source_evidenceePCR859WS150 Sequence/Annotation Release
Chunk_score Abs_score754
Max_abs_score754Y25C1A.12
Specificity_index0.837
Rel_score1
Map_statusUnique_ePCRII30984023100556
Y25C1A.10 Chunk_score Abs_score71
Specificity_index0.079
Rel_score0.094
Y25C1A.9 Chunk_score Abs_score76
Specificity_index0.084
Rel_score0.101
Overlaps_transcriptY25C1A.12 Source_evidenceePCR859WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y25C1A.122155cctccattctccctgttagaactgaaaatatcgtttcttaattcccgatttgagattaaaagtgctattgggctgtagacatgttgtacatcgaatatatgaaatgcgattgaaagcatcattgcgcggatgcttgggatagaggtagcaaggaaggcaaaataaatctgaaaaggccttagacttaggattatttatttgaagaattgttcctaggcctattggactaaagtaagcctagaggtacagtattaggaagctctaataatcctacttcaaactttactaatcccttaggatcggtaaagtacaccagtacagctaggacttctacagtacctccttacaaggaaagtaagtcaatctagtcccggactttaaatcgagacgtatgtcatttgaaagcttatttttagcctagattaccacaaaaattttagcggcggaactcaactctgaacccctgaaagcgccatctgaaaaattttctctgcgccctcctagttttcaatactatttcgtatttattcattttacatatacaaaaattatcttcaatatttataaaatagtttaaaacattgaaaacaataaaaatttttcaaaaaaaaattttttgaccaaaaatttggcttccactggaccgcaaaaaattcagattttttgcaaaaaaataaaaatttccaaaaatcttccacattgtttgtttgaccctaaatgttcacaaaaacaatttttaaccgctcatagccacttttaaggccatttacttgacctagaattcagcaaaaaaatgcactggagcactttcagatggcgctttcaggggttcagagttgagttccgccgctgaaatttttgtggtgatctagtctaaacataagctttcaaatgacatatgtctcgatttaaagtccgggactagattgacttcctttccttgttagaaccctctcaggatccctacagtaccccatcactcgtaggacttctacagtactccccttaaaaattgtacagtacctctccccctacagtatccctttcaagtcggcctacctgtgtaaatgcgaacaacgtcgtctgtaaacccattatcaatgtgaaaattgtcaggtatctctcaacgtttttgattctatattccagtattgttaggccatatatggtgactataaagaatatggtaaccagtacaacacatgggatacagtggaataggttcaggagagaggtgttggcctgaaagcagatttttttttcaaaactttagaagtcaactttaaaaaattttgactctcacttgtttaactctgaagtttgtgggtgaaaaatcctaatttaacagcaattttacgtatttatctaaaattttcagcctaaactatgcactaaactgacaaaactccgtatctcagtggttaactgagtcgctactcagccaatttaccaaaagttgagctaagtttgtggtatctgttagttgaggtgctaaatctaaattttatagttagaatttacaagacctagattacccatggaatcgctgccttgtaatttacagaaaacccataaccacttggattgatatacaccctagatagtagaatattccagattacaccgaaagggagcaggtattgagcaatcagtaccggccgcaatattctcttccataactgaaactctaacttctagatataaatgctcaaaattgtaaaagttaccgtaacatgtctaactggaagtacaacacatgtcattctattaaaacttatcacaatttgagaaatagttttgaatgctgcgttgtaggtggacatagtgtaataggttttggtgattatagatggggtgaagaagtacggagctataattggacaaaggggagatactctaccaataaggcggctgaaaaatgcagcaactagcgtgtcatagatgctctggaagtttacaaaaattaagtatacgaatttcgagttgaaacagctccttcgccaactcactataattgcctccgaggtgtacagataataaaacgagttgctccgatacttttccttatttttcgatttaaaaattgcacaaataattagaatattcagagtagcaccgagaactagatagctagcctgcacaaggtatatcaaaa