Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y38E10A.y   

sjj_Y38E10A.y RNAi JA:Y38E10A.y
Simmer:Y38E10A.y
PCR_productsjj_Y38E10A.y
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y38E10A.24 Source_evidenceePCR292WS150 Sequence/Annotation Release
Chunk_score Abs_score251
Max_abs_score251Y38E10A.24
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1267841312679435
Overlaps_transcript Y38E10A.24.2 Source_evidenceePCR286WS150 Sequence/Annotation Release
Y38E10A.24.1 Source_evidenceePCR292WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y38E10A.y1023gttgttcacagtcgattcattcaattttccaatgattaaaccattatttttcgcttggaaaacctaacaaaaactatttccacaaaacccctatttgaaaaaccacccttttcacaaactgctaaacaacacgcgccaccgaaatatcggagcgtcgttgtctcacattttatttgtcgtcgaatttattttctgccggtttttaatcgatttttcgggattttattgattttttcttatttttctttattgaaatattgataaaatacgttatttttcacctataattcacgtttaataggcgttaaagtgaaagttattgaaaatgaattaaatgaaaattacgtggattttaagatttttagagtcagttcttcattttttcatctgaaatttagtttctataggaaaataatgatttttcaataaaaaatccctaaaattgctgattttcccttaatttctcttgattttctgtatttctccgagttttcttttaaaaaatgccagtttttttgcagaatgggtaccttcaccgccacatatttcctcaagaacgctttttgggacaaaagaggcctttggactgccacgttggccgtcgcctatttcgcccgctgctgggagagcgccggatacaataaggccgagatgatgaaggtaagcgtgctgaaatcgtgctgaaaattcaatttttagcatattttaacctaaaaatccataaaaccaattgatttttgtttcagggtcactcaaaaatgtacgcggatcgactcaagcagcttccagcacacaccgacgcctggaaatactgaaaatcccgccgactagatgcttaatttagcgatttcctgtgttttttctcgatttttagtcataaagaaaaattttaaacattttattatgcttcagcacattcacaaatgcttttctccgagcaaatgacacgttgagtggggcaaaactgaaaattttagatcgaaacttgctaaaatcggatgaaagcactcaccgagtagaaaa