Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y38H6C.1   

sjj_Y38H6C.1RNAiJA:Y38H6C.1
PCR_productsjj_Y38H6C.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY38H6C.1 Source_evidenceePCR273WS150 Sequence/Annotation Release
Overlaps_Gene Y38H6C.1 Source_evidenceePCR354WS150 Sequence/Annotation Release
Chunk_score Abs_score312
Max_abs_score312Y38H6C.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV2049593920497079
Overlaps_transcriptY38H6C.1 Source_evidenceePCR354WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y38H6C.11141ttttcccaaaagtatgtgaccattacaagtttaaaattacaaaaattattttattacaagctcataatagaataaaatttcaaaacaaaaagaaaatctattgcttcttggcggcctcgataagctcggccttcttcttctcaataatgacagcgtagatcttctgatcggcttccgattgtcccttaatatactcattggtctctccgatcatttttgtgataattgccaaagaagtggcagcatcacgttctggctcatcgtccttcttcttgtaagtggcggcgattttgagaattccctcgatggattctggcgagagaccggcggctgtcatctcctccttggcttttgcgactgaaattttttttacatattagtagggtattaggagacctacaaaaaatccgaaaattttcaatttttggatttttattaggtaatttgcgtggtttgatctacttagatcttcgaaaatggcgggaattgagatgcagacttcttaactgattttgcatggttaagaacgtgctgacgtcacatttgtttgggttaaaaaatcccgcattttttgtagatcaaaccgtaatgggacagcctgacaccacgtgtgtgctgtacttttcaagttggttgtatgttcgggtagtttccgatatttttaataaactttttttattggaagcgtgtggtgtcagactgcccattactgtttgatctacagaaaatgcgggaatttttttccaaaaatatgtgacgtgtcagcatgttcttaaccatgtaaaatcagttgagaagtctgcgtctaaattcccgctttttttgtagatctcaccaaaatgggacagcctgacatctaaaaatgtaaaaaattaaatcattttttggtgttgtatcctataatatctggaatatgaggttattgtacaattacatgtaaaaaatcaaaacaataacttgctaaagaattacatacttttttctgccgaaaaatcaacaaaaattgaaaatttcaatttttcgccattttcggtcttattgttaaatttttttcaaattgaacaaaaaacatgaattcttgaaaaaataagcatacatccaaaaactcacgtttctcggccatttttagtgttgattcagc