Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y39A1B.3   

sjj_Y39A1B.3 RNAi (2)
PCR_productsjj_Y39A1B.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY39A1B.3 Source_evidenceePCR983WS150 Sequence/Annotation Release
Overlaps_Gene Y39A1B.3 Source_evidenceePCR983WS150 Sequence/Annotation Release
Chunk_score Abs_score941
Max_abs_score941Y39A1B.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1076886110769956
Overlaps_transcriptY39A1B.3 Source_evidenceePCR983WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y39A1B.31096aaagaaaattggtcgttgcgagacctgagaaacgccctgagagtacagtacccttataattttccagccgtgaccgtattccaagcctccgcgagcgccgtagcgacgatatggaagacgacgatgatgatacggtatctctggaggatgatgatatgacgtcacttgttagcgaagttgttaaatgggttgttgcacaggccgaggaggattatgtcacttttaaggtactttttgtataatttttggatataaaaacggttgaaattttaggttcaactaacccaaatggacgatgatcaactattggaaaatgagcaagaagcacgagaccgtaacaatcaaataatgcagttgagagctcaagttcaacaattaatcaataaaatgagcatcgagcaagagctgagtcggtgtgtcacgatagcgttacgatgtgttctgaacggagagactgcagagattaaagagggaatccgattcttgacgagatgcaagttattcgagatcacaggagcagatgatgcgattcgatcgatgtgctcgttggtttggaggccatccgctgatattttaaatgaattaattgaagctgccgaggatatgtttattagtcgattggatggaaatgaaaaagcatcggaaagagattcatcaacagttgagaatctaatgaaagcaatgaacggagttacagaaaaagatcgtccatctgttgaagaagttatttatcttttagcagccactgaacttgtacatgttgatagtgataagaacaaagttccacgtaaaagacgtcccatcgaagcaaatgtgatcaataagctatggatgattgcactcgacatgtcgcatggcatcaattcccggaaaatcgatgctttacgaatactctatccaatttctagaagtgaacgaggaatcgctgaggcgagatctcgacttcgtgtagttcagaagaagctgatggatccagagttggctgttgatgcgttgaggattatttcgattctaggcacgccgacaaagttggaaaatgaacaggatgcgtatagcaggcctttgttcaagattcatcaggatgattcgttgtgga