Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y39A1B.3   

sjj_Y39A1B.3 RNAi JA:Y39A1B.3
Simmer:Y39A1B.3
PCR_productsjj_Y39A1B.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY39A1B.3 Source_evidenceePCR983WS150 Sequence/Annotation Release
Overlaps_Gene Y39A1B.3 (3)
Overlaps_transcriptY39A1B.3 Source_evidenceePCR983WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y39A1B.31096aaagaaaattggtcgttgcgagacctgagaaacgccctgagagtacagtacccttataattttccagccgtgaccgtattccaagcctccgcgagcgccgtagcgacgatatggaagacgacgatgatgatacggtatctctggaggatgatgatatgacgtcacttgttagcgaagttgttaaatgggttgttgcacaggccgaggaggattatgtcacttttaaggtactttttgtataatttttggatataaaaacggttgaaattttaggttcaactaacccaaatggacgatgatcaactattggaaaatgagcaagaagcacgagaccgtaacaatcaaataatgcagttgagagctcaagttcaacaattaatcaataaaatgagcatcgagcaagagctgagtcggtgtgtcacgatagcgttacgatgtgttctgaacggagagactgcagagattaaagagggaatccgattcttgacgagatgcaagttattcgagatcacaggagcagatgatgcgattcgatcgatgtgctcgttggtttggaggccatccgctgatattttaaatgaattaattgaagctgccgaggatatgtttattagtcgattggatggaaatgaaaaagcatcggaaagagattcatcaacagttgagaatctaatgaaagcaatgaacggagttacagaaaaagatcgtccatctgttgaagaagttatttatcttttagcagccactgaacttgtacatgttgatagtgataagaacaaagttccacgtaaaagacgtcccatcgaagcaaatgtgatcaataagctatggatgattgcactcgacatgtcgcatggcatcaattcccggaaaatcgatgctttacgaatactctatccaatttctagaagtgaacgaggaatcgctgaggcgagatctcgacttcgtgtagttcagaagaagctgatggatccagagttggctgttgatgcgttgaggattatttcgattctaggcacgccgacaaagttggaaaatgaacaggatgcgtatagcaggcctttgttcaagattcatcaggatgattcgttgtgga