Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y39G10A_236.b   

sjj_Y39G10A_236.bRNAiJA:Y39G10A_236.b
PCR_productsjj_Y39G10A_236.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS W03F11.6a Source_evidenceePCR615WS150 Sequence/Annotation Release
W03F11.6c Source_evidenceePCR615WS150 Sequence/Annotation Release
W03F11.6d Source_evidenceePCR615WS150 Sequence/Annotation Release
Overlaps_Gene W03F11.6 Source_evidenceePCR615WS150 Sequence/Annotation Release
Chunk_score Abs_score594
Max_abs_score594W03F11.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI21960502196664
Overlaps_transcript W03F11.6c Source_evidenceePCR615WS150 Sequence/Annotation Release
W03F11.6a Source_evidenceePCR615WS150 Sequence/Annotation Release
W03F11.6d Source_evidenceePCR615WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y39G10A_236.b615ctcggaaagtgtcttcagtatcggatagagtcgattcacagattctgcgaacgaatgggcgtcgagatggccgccgagtgccatttggatagatcccgtcaggccgctaaccttctcgccacgcagaagaatgatgttgccgcgttgggatcgacgtgctataagctgaacagcctccaagtggttcatatcctgtcgggattcgaaccagacgacggcgagattccatgtgacgatgacgtcgttgatcggatctgtagactcgctgaaaaacaggcggataagctgacgttggaggatgggcagcgcgtgacactggaggagtccgacgagctgaaccttccgttcctgatccctcaggatggttactttgtcgagcagttccgaacggtgccagatggtctttggcagtacttgcagcaacttcagcataggcgcctctgtcatacggtgtcgcttacaccggcaccgccggctgcgatgacccattcgatgcatgcgatgcatattggagcaagcgatgctcattatcatcagcatcagcatcagcagcagcagaacccgattgtgagaagtgtgtcgcagactacactgaccagtattccgactacacaa