Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y39G10A_236.c   

sjj_Y39G10A_236.cRNAiJA:Y39G10A_236.c
PCR_productsjj_Y39G10A_236.c
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS W03F11.6a Source_evidenceePCR610WS150 Sequence/Annotation Release
W03F11.6c Source_evidenceePCR610WS150 Sequence/Annotation Release
W03F11.6d Source_evidenceePCR610WS150 Sequence/Annotation Release
Overlaps_Gene W03F11.6 Source_evidenceePCR610WS150 Sequence/Annotation Release
Chunk_score Abs_score589
Max_abs_score589W03F11.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI21954052196014
Overlaps_transcript W03F11.6c Source_evidenceePCR610WS150 Sequence/Annotation Release
W03F11.6a Source_evidenceePCR610WS150 Sequence/Annotation Release
W03F11.6d Source_evidenceePCR610WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y39G10A_236.c610ctgccaccgtactctacaaaatccgcgcaggaacccctccaactgccgctctcaattcaaatcggcgactacaatgtatgggatttcctggccgaagtgatgtcgaatcgtgcggcaacctcatcggaaatgtccacattccgcctatcgcctgcctactctctctacctggcacttcgatcattccacacacacaataaaccgtactctgtgcaattcttctcacggatcgagtcgaatttcaagcaaatcgctcaggaatgctcgtcgaaggatgatctgatcttttggcttgccaacgcatcggaattcaatcatcttgtcgagcgggacactgagctgaaagcgtcgagatatggcaaaatatctgtggaaattgagagaatattccggcgattggttgcagtgcttcaaagtgtcatccgtccggcggcgcgggctctgttggacattcatctgaatgatcacgacgcgaccggcgatgtgattcatcttctcgacaccacgatgcgccaggcgagaatttgtggtctcaacgcggcgctcacaattcaactgtgcgggcatctcctccacatggtcaatgcctttgtgttcaacagcttggtct