Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y39G10A_237.b   

sjj_Y39G10A_237.bRNAiJA:Y39G10A_237.b
PCR_productsjj_Y39G10A_237.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y74C10AR.1 Source_evidenceePCR136WS150 Sequence/Annotation Release
Y74C10AR.3 Source_evidenceePCR114WS150 Sequence/Annotation Release
Overlaps_Gene Y74C10AR.1 Source_evidenceePCR136WS150 Sequence/Annotation Release
Chunk_score Abs_score118
Max_abs_score118Y74C10AR.1
Specificity_index0.565
Rel_score1
Map_statusBest_ePCRI24852232486421
Y74C10AR.3 Source_evidenceePCR114WS150 Sequence/Annotation Release
Map_statusTop50_percentile_ePCRI24852232486421
K10G4.7 Chunk_score Abs_score91
Specificity_index0.435
Rel_score0.771
Overlaps_transcript Y74C10AR.3 Source_evidenceePCR114WS150 Sequence/Annotation Release
Y74C10AR.1 Source_evidenceePCR136WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y39G10A_237.b1199atttctgatgagtgctggtgattttgtcagtgacgagaaactgcggtaaactgcctgaaaatcaatattttaccggaaattctcgggttttttaacgatacctgcgatctgatagtgtttgacgcgttccgtaggccagctattagtcgtaattgtaacattatcgatctctgaaaactggattcggtgaagctttcgcaaaaaaatcgatgagaattgagagttgcgaaatttagcagttatttgtggtggaacatgttaaaatttgagtttttaattaatatattgctaaaaatttgataaaattcactttttaattgttgaaaactactgaaaaccactcgaaattgctgaaaattgctgaaaatcgaaatttcgtcagctgatgtcgattattctgcgcgggggtacggtacgcaagtccgcaaacactgtcacgccaaattgcggaggttgagccaaatcctatttcttgttgttttttcgcttatttttcgaatatttcccatgttttctggcttctaattttcatttttttaatggaatttattaataattaagccaataattcattttataatcaaaactgccgaatattccaccaatttctcgcagaaaccttcaaaaataggggatttctttcagaaatgcgtccactttcgctgaaaggccacgaacgtgctctcactcgggtccgtttcaatcgtgagggagatttgacgttctcctgtgctaaggacaagaagccatgcgtttggtatactgaaaatggagagagaatcggtatttttgaatattttcgcgaaaaattttcgcagaattaaaggtggagtagcgctagtgggaaaattgctttaaaacatgcatatggtaccacaatgaccgaatatcatgattaaaaatttcaaaaaaattttctaaattttatatgattttttgaaaattgaaaaaatctcagtttttgcctaatttcaattttaattaccgccaattggatttgttcgatggagcgcgcttgcacgtttttaaatttatttattttatttattgttattttccaccgatttttaatgttttcggtgtatttttgcttgaattttagagaaaaagtcaaaagaattgcaaattttcaattaaaaagcacgcttacaggcgtaaatcagtgaaatttattaattcaggttcgaaatcgtttaaaa