Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y39G10A_246.i   

sjj_Y39G10A_246.i RNAi JA:Y39G10A_246.i
Simmer:Y39G10A_246.i:Screen_A
Simmer:Y39G10A_246.i:Screen_B
PCR_productsjj_Y39G10A_246.i
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y39G10AR.13 Source_evidenceePCR1828WS150 Sequence/Annotation Release
Chunk_score Abs_score1723
Max_abs_score1723Y39G10AR.13
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI23047642307100
Y39G10AR.9 Source_evidenceePCR48WS150 Sequence/Annotation Release
Overlaps_transcript Y39G10AR.13.2 Source_evidenceePCR1826WS150 Sequence/Annotation Release
Y39G10AR.9 Source_evidenceePCR48WS150 Sequence/Annotation Release
Y39G10AR.13.1 Source_evidenceePCR1828WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y39G10A_246.i2337ttgatggactctttttccacactgctgacgatccgcgcttcttgactttgacagcatcactaaagatttcctttagatttggctgaaaatttttaaatttttactgaaggagctgcaagaaaaaaaaaacaattacctttccaatcgatccgaagaattgagccacgtcgaatggtggattaatggcatgtcttctgacattctcacggacaactgcgaattcggcccaagccgggacatctttgcgtggatcatcttcttgatctgtctcgtcatcactgttaagatcgttcaaaccatagtcattctttgagttgttttgataggtacgtggcggagtcatttcgtaggctgcaggtggtggcgtttttcgaagagcttcctgacgagcttgtttctccgcgcatcttgcgagtgttgcctggagctctgcctcttctcgctctctttgcttctccagctgagcttgctcttctctctgaacggccagaaaatgctcctgctcttctcgagctctgagttgacgctccttctccgctttctctttcatttccttctgctcccgctttcgtcgttcatcttctgctaactgtagcagatactgctcctgttccagctgaatacgttgctgttcctgaagagcggcaagtgcggcagcagcttcaacatttgatgtagaagacgaagctgcgtgggccgatcgtttcgtcgctttcgcctttggtttatgttgacgcgccggtggagttgaatcatcacagctcatcggctccattttgacttgccggctaccgtttcgttgcaattctcgggaaggctgaaatgagttaaattattattaggaaaatacaatcaagtaaatactcaccgatagttcaacggtcggctgagccacaggagcagtcttctgtccatctgagccaattagaatctcaacttttcccttcttagcagggcctcgaccaggagtggatgtgctttccgccgttgggaagatttttctacttgcagccttgtttggagcatggtcttgcatcaaacgagctcttgttggcgactttgcactgttgtgaagtttcgccaaattagcattacgctcttccttttgcttcaactggtcgagcttttcctgacgaactctttcctgctcttttctgcgctccatgacagcattccgcttctcctcgtccttccgtgctttctcccttttcttctcgagctctttcatccggagctcatcagcatgcttcatccttgcattcggatctttttctgcatcattgaacggaatcacacgatggggcgtccttggaaccacagctgcacggccgggagttcctgccatacgtccaggtgttgacgagaaaatgttgcgcggagtagcttgattgtgagcctcacgcggtggatttctgcgaggagtgccactgtacgctgcatttcgtgagatgcttccttcggtcttctttttggatatgctcatttgctgcatgcgcttcaacgtgactggcaatatgtcctcttcgaaatcaccatcagtcgctactgagccggctcgtggagtgatgggtcctgcttgatctgtctcgacttcgtcggtttccatatcatcatctccgcggtgacttgaactggacggttgagcgggtttcgctttctgaaaaaaataagcattgacggaataaagtaaatttgagattttcttacctgtcttgaaatcaactcaacaaactcagcatcaatgcgtccgggttttaggacggcatttaatagctgttccgccgagaattgaggcgtggccagttcttctgtgatcgaggacatcctcttgtacagatctgcgaaaacttttgcagccgcgtcgtcatgagcctcgcttacttcatcgaatatctgaaagaaatattttatatcaaaagaaattattcataaacacaaaccgacgaaattttcgggatactcgaaaacagtttgatggtgggctcggctggctttcgcgagactgcgcgcttttttggtggcatctttctggaaaaaaaaactgatttaaactctgtaaaattttcgaaaagatgaacaaaagtcgaaaaacgagcgggaaaacaatgggagggctgacaattcgaatggaaacgattcccgcgcgtgcgcaaacatagtagggtgtacaatagagcagggttgccaagcgcctcattcgacaaaaacaaagatgtttaaatagatgtttcggctatacaaattattcagaaactgctggacaaagttggagaaaagtaagattttaaaggaaaaaacaggtttttaaacgagattggagtgttataacgggaattg