Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y40B1A.4   

sjj_Y40B1A.4 RNAi JA:Y40B1A.4
Simmer:Y40B1A.4:Screen_A
Simmer:Y40B1A.4:Screen_B
PCR_productsjj_Y40B1A.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY40B1A.4 Source_evidenceePCR406WS150 Sequence/Annotation Release
Overlaps_Gene Y40B1A.4 Source_evidenceePCR406WS150 Sequence/Annotation Release
Chunk_score Abs_score324
Max_abs_score324Y40B1A.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1336164113362807
Overlaps_transcriptY40B1A.4 Source_evidenceePCR406WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y40B1A.41167tccgaataaattaaaaagcgacaaaccttgtaaacttcttattacaatgttgccaatcacatgcaaatggtttattaccagcgtgtccacgtaaatgtgctctcaaatgagacgtttttccgtatgttttgttgcataaatgacaaatgtgaattcgactttttccgtctcctctgaaattggaaaatatgaaaaaaaaaattttttttttgagcgaaatttgagggaatttctcaaaataatttttttgattcagtaaaaacctgaaaaaagtttttgttttgttgaaaaatcccatttttagaattttccggaacaaaaaatcccaagaattttggtttttggagcttttcaagaaaaactaaaaatgtttagattttcgcagcttgtgtactcctcgaggagaagttttaacaatttttagctgaaattcttattttggaccatttttctaaatttttttgtaaaaaatagcagaaactgtccaaaatcagagagtttcagcgaaaaattgttaaaacatctcctcgaggagtacacaagctgcgtaaatctacacatgattgtgtttttcttgtaaaagtgccaaaaaccaaaaatgtttgggattttttttgtgccaatttctttaaaatttcggtcattttcaatagttacttattaatttttgaaaaaaaaactcagatttttatctggaaaaacgctaaaaattgcaatttttgtgaaattttttcaatttttcacccaaactttcagaaatttttttttcaattttctgcaatattgacagaatttcttccattttccatcatttttttcggttttttctccaaaaaaatgtccatcaaactactaactgtcgattattctgctgtaaacaatttggacacgtgcatgcacatctttttggtgcttcaccgagtccttgtccattaatatctccataatcatttcccatattcatcattccatcctcgttcatttgtggaatcatttgacgatgttggatttgattcggctgaaaattttagattttcaacgttttttcggattaaaaaaatacttttctcgctggagcagatggtcctgcaactggtggtccttcatttgtgattatccatttttgaggatcattcggatcctgttggaagtgaagatttcctgaaa