Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y40B1B.6   

sjj_Y40B1B.6RNAiJA:Y40B1B.6
PCR_productsjj_Y40B1B.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y40B1B.6 Source_evidenceePCR756WS150 Sequence/Annotation Release
Chunk_score Abs_score714
Max_abs_score714Y40B1B.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1344226213443940
Overlaps_transcript Y40B1B.6.1 Source_evidenceePCR756WS150 Sequence/Annotation Release
Y40B1B.6.2 Source_evidenceePCR756WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y40B1B.61679atcgaaaacgaaaaagtgaaacattttttattaaataagtgttaaatttgacaaaattaattttttttttccgactttttttttggatttttcaataaaacaaaaatttcaggtaaacttcgaagagcacggagtattcgatttcacctcagtattcgtcgagggtcgtccattaaacgaagaaaagattcatttattcctagatcactataaatctgctcacggagccctaaactatcaagcccatcaatgtgagcatcgtgatgatcagggatcatttatttcccgacaacaagcctatgagaatctattaagtatgtgtgaacgtggaacacttatcaaatattataacttttgtaaatcactggaaaccgtcgcccgagcccgtgagcatcatttcaatcaaatgaaacagttgagaatgacagcattgatggctgaaaatcagctgaaaaaaatggaagaagaaggaaatttggagcaggatccggtgctcagaagatcattaaaacgggatattgcaacatcactcgagaaatttgaagaagtcgctgacgcttttgagacggctgataatcattggcaacggcttaatgagcatccacaggcgaaacaatatatgcatccgggatctgaattcgcgacttttaattttatgttgggatttgaggagtatttggttggagcacaattggaaaaagtgcaattctcgtgtgattcgatgcaaaataaggagaatggagtggcggcgagatgttagtgatttgaaaagagcaaaatttgatggaaaatttggaattttttcgttgaagaatttgaaagtttaaggaaaatgggaaaatttaaattttggacttttttttgacaaaaaattggcaaaattttataaaagtgcgaaaaaatcgaaaattttcgatttttcgaaaaatcgaacgagaagaaaattcaatggaaaacatttgaaatttcatgaagaaacctgaaaattgtgacgaattttcgatttttaggcaaaaaaaatgatttcctattttttttcactttcgaaaaaaaaactgaaattttgtcaaacaaacttaattcaatttttttaaagaatttttctgccaaaaattggattctctatttattttcgtgttaacgcatttgaaattcgagaaaaaattggaaattttcaattttggaattttttggcgaaaaaaaattccgcaaaaattgataaaattgcagaaaaaacggaaatttttagcgaaaaatagcttttcctgaaaattgaaaaattcacgtgtattttttgattttttgaatttttttcctaataaagtcgtaaaaatctgtgaaaattcacgaaaatctttcaaattttcggataattcagttcaaaacgctcgaaaatttgaataataatccaaaatccacgtggatttattgattttttgaatgatttttggattttggatagaaaatgtcaaaaatcgtcaaaatactaactagaacagtgataattgaaatttttagactatacaggcttaatccaatgaaatataatcatcaataaaattacagtaaccgaaggaattgccgaactgctaacacaattatcggaaaaacgaaaattggatattcgtctgaagcatcgtgttttggatattgattatagcggatttgagcatgtttta